Transcript: Mouse NM_178713.4

Mus musculus aldehyde dehydrogenase 8 family, member A1 (Aldh8a1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Aldh8a1 (237320)
Length:
2243
CDS:
42..1505

Additional Resources:

NCBI RefSeq record:
NM_178713.4
NBCI Gene record:
Aldh8a1 (237320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178713.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028476 CCACGGTGATAACAGACATTA pLKO.1 1165 CDS 100% 13.200 18.480 N ALDH8A1 n/a
2 TRCN0000041642 CCACCAGGTGTGATCAACATT pLKO.1 639 CDS 100% 5.625 4.500 N Aldh8a1 n/a
3 TRCN0000041638 CGTGTGTTGTTCCGTTTGATA pLKO.1 1231 CDS 100% 5.625 4.500 N Aldh8a1 n/a
4 TRCN0000041641 CGAGAGCTAACAGTGTTAGAT pLKO.1 1270 CDS 100% 5.625 3.938 N Aldh8a1 n/a
5 TRCN0000041640 GCTACCAGAAAGTGGAAAGTT pLKO.1 969 CDS 100% 5.625 3.938 N Aldh8a1 n/a
6 TRCN0000041639 CCCTTGGAATTTACCACTCTA pLKO.1 497 CDS 100% 4.950 3.465 N Aldh8a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178713.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03955 pDONR223 100% 85.4% 89.9% None (many diffs) n/a
2 ccsbBroad304_03955 pLX_304 0% 85.4% 89.9% V5 (many diffs) n/a
3 TRCN0000475480 CCCGTTTGCATGGGTATGTAGGTT pLX_317 22.5% 85.4% 89.9% V5 (many diffs) n/a
Download CSV