Transcript: Mouse NM_178720.4

Mus musculus zona pellucida like domain containing 1 (Zpld1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Zpld1 (239852)
Length:
2589
CDS:
160..1407

Additional Resources:

NCBI RefSeq record:
NM_178720.4
NBCI Gene record:
Zpld1 (239852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178720.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246447 CCGTTGGAATACCTGGTTAAT pLKO_005 631 CDS 100% 13.200 18.480 N Zpld1 n/a
2 TRCN0000246449 CAATTAATTATCCCGAGTATA pLKO_005 760 CDS 100% 13.200 10.560 N Zpld1 n/a
3 TRCN0000246446 GACATTGTCAGCACCATATAA pLKO_005 2230 3UTR 100% 15.000 10.500 N Zpld1 n/a
4 TRCN0000246448 GCCATTACGATGAAGATTAAT pLKO_005 301 CDS 100% 15.000 10.500 N Zpld1 n/a
5 TRCN0000246445 TGATATCAGGAATGGTCATTC pLKO_005 1280 CDS 100% 10.800 7.560 N Zpld1 n/a
6 TRCN0000129165 GAATGGTCATTCTGGGAGTTA pLKO.1 1289 CDS 100% 4.950 3.465 N ZPLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178720.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13159 pDONR223 100% 87.6% 91.3% None (many diffs) n/a
2 ccsbBroad304_13159 pLX_304 0% 87.6% 91.3% V5 (many diffs) n/a
3 TRCN0000478128 CGTTCGTTTGTGACATAGAGCTAG pLX_317 25.5% 87.6% 91.3% V5 (many diffs) n/a
Download CSV