Transcript: Mouse NM_178726.3

Mus musculus protein phosphatase 1 (formerly 2C)-like (Ppm1l), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ppm1l (242083)
Length:
3962
CDS:
650..1732

Additional Resources:

NCBI RefSeq record:
NM_178726.3
NBCI Gene record:
Ppm1l (242083)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178726.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080874 CCGTCCATCTTCGGAATCTTT pLKO.1 1010 CDS 100% 5.625 7.875 N Ppm1l n/a
2 TRCN0000080876 GCAATGAAGAAGCGGTTCGAT pLKO.1 1575 CDS 100% 3.000 4.200 N Ppm1l n/a
3 TRCN0000080873 CCCTTCTATCAGTGTTTGAAA pLKO.1 1934 3UTR 100% 5.625 3.938 N Ppm1l n/a
4 TRCN0000080877 CCTATGATGAAGCAGGCACAA pLKO.1 1209 CDS 100% 4.050 2.835 N Ppm1l n/a
5 TRCN0000080875 GCCGAGATTATGCAGAACGAT pLKO.1 839 CDS 100% 3.000 2.100 N Ppm1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178726.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13279 pDONR223 100% 57.6% 62.7% None (many diffs) n/a
2 ccsbBroad304_13279 pLX_304 0% 57.6% 62.7% V5 (many diffs) n/a
3 TRCN0000477392 ACAGGCCTATCCCGGCGGGGTGTA pLX_317 61.6% 57.6% 62.7% V5 (many diffs) n/a
Download CSV