Transcript: Mouse NM_178779.4

Mus musculus ring finger protein 152 (Rnf152), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rnf152 (320311)
Length:
8529
CDS:
616..1227

Additional Resources:

NCBI RefSeq record:
NM_178779.4
NBCI Gene record:
Rnf152 (320311)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178779.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037345 GCTACACAACATGTCCTGCAT pLKO.1 1173 CDS 100% 2.640 3.696 N Rnf152 n/a
2 TRCN0000037348 GCGTGGTGAAGAGCTCCACAT pLKO.1 1091 CDS 100% 1.350 1.890 N Rnf152 n/a
3 TRCN0000037346 TCATTGCCATACCACACACTT pLKO.1 848 CDS 100% 4.950 3.465 N Rnf152 n/a
4 TRCN0000037347 CAGTCTTCATCAAACTTCCAA pLKO.1 881 CDS 100% 3.000 2.100 N Rnf152 n/a
5 TRCN0000037344 GCCCAAGTTGTTGGATTGCAA pLKO.1 687 CDS 100% 3.000 2.100 N Rnf152 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178779.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09860 pDONR223 100% 88% 97.5% None (many diffs) n/a
2 ccsbBroad304_09860 pLX_304 0% 88% 97.5% V5 (many diffs) n/a
3 TRCN0000476363 TTCCGTTAGGACTGTCTCCACGAC pLX_317 18.9% 88% 97.5% V5 (many diffs) n/a
Download CSV