Transcript: Mouse NM_178791.4

Mus musculus V-set and transmembrane domain containing 4 (Vstm4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Vstm4 (320736)
Length:
2743
CDS:
157..1116

Additional Resources:

NCBI RefSeq record:
NM_178791.4
NBCI Gene record:
Vstm4 (320736)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174443 CGAAGATTCATCATTTGAGAA pLKO.1 630 CDS 100% 4.950 6.930 N Vstm4 n/a
2 TRCN0000174016 CGACGGAAATGAGAGTGATCT pLKO.1 596 CDS 100% 4.950 6.930 N Vstm4 n/a
3 TRCN0000193668 CCGTGAATTGACATTTCTGAA pLKO.1 2573 3UTR 100% 4.950 3.960 N Vstm4 n/a
4 TRCN0000174030 CTGCTGAAACCACAGAGGAAA pLKO.1 961 CDS 100% 4.950 3.465 N Vstm4 n/a
5 TRCN0000194591 CCACCACTTTCCACAAACCAA pLKO.1 938 CDS 100% 3.000 2.100 N Vstm4 n/a
6 TRCN0000194477 GCCACTTATGATGACATCCAT pLKO.1 1590 3UTR 100% 3.000 2.100 N Vstm4 n/a
7 TRCN0000194117 GAGTGAGACATTATTTGGTGA pLKO.1 785 CDS 100% 2.640 1.848 N Vstm4 n/a
8 TRCN0000138697 GATCCTCTTCGAGGAGAACAA pLKO.1 1089 CDS 100% 4.950 6.930 N VSTM4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178791.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09793 pDONR223 100% 85.7% 86.6% None (many diffs) n/a
2 ccsbBroad304_09793 pLX_304 0% 85.7% 86.6% V5 (many diffs) n/a
3 TRCN0000478079 ACTGGCAACTAAAAAACCGACCGT pLX_317 33.8% 85.7% 86.6% V5 (many diffs) n/a
Download CSV