Transcript: Mouse NM_178795.4

Mus musculus diphosphoinositol pentakisphosphate kinase 1 (Ppip5k1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ppip5k1 (327655)
Length:
5559
CDS:
126..4436

Additional Resources:

NCBI RefSeq record:
NM_178795.4
NBCI Gene record:
Ppip5k1 (327655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439479 GTTCGAACTCGGCTCTATTTC pLKO_005 2610 CDS 100% 13.200 18.480 N Ppip5k1 n/a
2 TRCN0000418964 TTACTTCTGCCAGCGCTTATA pLKO_005 4664 3UTR 100% 13.200 18.480 N Ppip5k1 n/a
3 TRCN0000416155 AGCCGAGTTACTCCGTCTTTC pLKO_005 2396 CDS 100% 10.800 15.120 N Ppip5k1 n/a
4 TRCN0000428411 GGGCGCTATGATATCAGTAAG pLKO_005 2307 CDS 100% 10.800 15.120 N PPIP5K1 n/a
5 TRCN0000178466 GCGCTATGATATCAGTAAGAT pLKO.1 2309 CDS 100% 5.625 7.875 N Ppip5k1 n/a
6 TRCN0000217896 GGTCACTTCTCAGGTATTAAT pLKO.1 1566 CDS 100% 15.000 12.000 N Ppip5k1 n/a
7 TRCN0000181385 CCCAAGAGGTTTGTCCTTATA pLKO.1 5374 3UTR 100% 13.200 10.560 N Ppip5k1 n/a
8 TRCN0000435906 GCCATGGAGTGGGAATCATAG pLKO_005 4734 3UTR 100% 10.800 7.560 N Ppip5k1 n/a
9 TRCN0000197756 GAAGATGTGATCCTAAATGAA pLKO.1 396 CDS 100% 5.625 3.938 N Ppip5k1 n/a
10 TRCN0000181384 CCCAGTGATGTAAACACTGAA pLKO.1 4449 3UTR 100% 0.495 0.347 N Ppip5k1 n/a
11 TRCN0000198957 GATCAGGTATTTGCCCTGATT pLKO.1 2151 CDS 100% 0.495 0.347 N Ppip5k1 n/a
12 TRCN0000182288 GAGGTCTCTGAGGAGATTGAT pLKO.1 4368 CDS 100% 5.625 3.375 N Ppip5k1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178795.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11402 pDONR223 100% 51.4% 55.5% None (many diffs) n/a
2 ccsbBroad304_11402 pLX_304 0% 51.4% 55.5% V5 (many diffs) n/a
3 TRCN0000480975 CACTCCTTTAGCACTTATAGATCG pLX_317 16.6% 51.4% 55.5% V5 (many diffs) n/a
Download CSV