Transcript: Mouse NM_178887.4

Mus musculus fibrinogen C domain containing 1 (Fibcd1), mRNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Mus musculus (mouse)
Gene:
Fibcd1 (98970)
Length:
4764
CDS:
224..1603

Additional Resources:

NCBI RefSeq record:
NM_178887.4
NBCI Gene record:
Fibcd1 (98970)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178887.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423090 CTATGCCCACTACGGGAGTTT pLKO_005 1246 CDS 100% 4.950 6.930 N Fibcd1 n/a
2 TRCN0000094804 GCACGAAACATGAGTAGAGTA pLKO.1 2949 3UTR 100% 4.950 6.930 N Fibcd1 n/a
3 TRCN0000436461 GAGCTTCACGTGGACCTAGAA pLKO_005 1205 CDS 100% 4.950 3.960 N Fibcd1 n/a
4 TRCN0000094808 GATGGCAGTATTCACTCAAGT pLKO.1 1542 CDS 100% 4.950 3.960 N Fibcd1 n/a
5 TRCN0000094805 TGATGGTGTCTACTCTATCTT pLKO.1 979 CDS 100% 5.625 3.938 N Fibcd1 n/a
6 TRCN0000094806 CTGTCACACATCCAACCTCAA pLKO.1 1456 CDS 100% 4.050 2.835 N Fibcd1 n/a
7 TRCN0000094807 CGCAGGTGACTCCCTCCTGAA pLKO.1 1339 CDS 100% 0.000 0.000 N Fibcd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178887.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09242 pDONR223 100% 85.6% 90% None (many diffs) n/a
2 ccsbBroad304_09242 pLX_304 0% 85.6% 90% V5 (many diffs) n/a
3 TRCN0000479008 GTTCCGTAGTCGATCCGCCATCGC pLX_317 18.2% 85.6% 90% V5 (many diffs) n/a
Download CSV