Transcript: Human NM_181054.3

Homo sapiens hypoxia inducible factor 1 subunit alpha (HIF1A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
HIF1A (3091)
Length:
3819
CDS:
293..2500

Additional Resources:

NCBI RefSeq record:
NM_181054.3
NBCI Gene record:
HIF1A (3091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181054.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003808 CCGCTGGAGACACAATCATAT pLKO.1 1500 CDS 100% 13.200 18.480 N HIF1A n/a
2 TRCN0000318675 CCGCTGGAGACACAATCATAT pLKO_005 1500 CDS 100% 13.200 18.480 N HIF1A n/a
3 TRCN0000054449 GCCGCTCAATTTATGAATATT pLKO.1 1107 CDS 100% 15.000 12.000 N Hif1a n/a
4 TRCN0000003810 GTGATGAAAGAATTACCGAAT pLKO.1 1056 CDS 100% 4.050 3.240 N HIF1A n/a
5 TRCN0000318674 GTGATGAAAGAATTACCGAAT pLKO_005 1056 CDS 100% 4.050 3.240 N HIF1A n/a
6 TRCN0000232223 TATGCACTTTGTCGCTATTAA pLKO_005 3601 3UTR 100% 15.000 10.500 N Hif1a n/a
7 TRCN0000003809 CCAGTTATGATTGTGAAGTTA pLKO.1 2552 3UTR 100% 5.625 3.938 N HIF1A n/a
8 TRCN0000318676 CCAGTTATGATTGTGAAGTTA pLKO_005 2552 3UTR 100% 5.625 3.938 N HIF1A n/a
9 TRCN0000010819 TGCTCTTTGTGGTTGGATCTA pLKO.1 3747 3UTR 100% 4.950 3.465 N HIF1A n/a
10 TRCN0000318677 TGCTCTTTGTGGTTGGATCTA pLKO_005 3747 3UTR 100% 4.950 3.465 N HIF1A n/a
11 TRCN0000003811 CGGCGAAGTAAAGAATCTGAA pLKO.1 377 CDS 100% 4.950 2.970 N HIF1A n/a
12 TRCN0000349634 CGGCGAAGTAAAGAATCTGAA pLKO_005 377 CDS 100% 4.950 2.970 N HIF1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181054.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491723 GGGCCCGCTGCGCCATCCCGCCTT pLX_317 9.5% 88.9% 88.8% V5 (not translated due to prior stop codon) 2202_2203insGGAAC;2205_2206ins268 n/a
2 TRCN0000489130 GCCTAGCCTAATGAGAGCAGCGAT pLX_317 9.3% 88.9% 88.7% V5 2202_2203insGGAAC;2205_2206ins269 n/a
3 ccsbBroadEn_06365 pDONR223 100% 88.9% 88.8% None 12C>T;2202_2203insGGAAC;2205_2206ins268 n/a
4 ccsbBroad304_06365 pLX_304 14% 88.9% 88.8% V5 (not translated due to prior stop codon) 12C>T;2202_2203insGGAAC;2205_2206ins268 n/a
5 TRCN0000475140 CCCACAATGCGGTACGTGCAGGGA pLX_317 14.8% 88.9% 88.8% V5 (not translated due to prior stop codon) 12C>T;2202_2203insGGAAC;2205_2206ins268 n/a
Download CSV