Transcript: Mouse NM_181318.4

Mus musculus RasGEF domain family, member 1B (Rasgef1b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rasgef1b (320292)
Length:
2993
CDS:
221..1639

Additional Resources:

NCBI RefSeq record:
NM_181318.4
NBCI Gene record:
Rasgef1b (320292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181318.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077696 GCGTACGTAGAATGGTTTAAT pLKO.1 986 CDS 100% 15.000 21.000 N Rasgef1b n/a
2 TRCN0000077694 CCTGCTTAGTTCTCGGTTATT pLKO.1 418 CDS 100% 13.200 18.480 N Rasgef1b n/a
3 TRCN0000077693 GCCTGAACATTTGCTGCTAAT pLKO.1 1977 3UTR 100% 10.800 8.640 N Rasgef1b n/a
4 TRCN0000077695 GCCAAACAAGTGAGTGAATTT pLKO.1 1433 CDS 100% 13.200 9.240 N Rasgef1b n/a
5 TRCN0000077697 TCCTGCTTAGTTCTCGGTTAT pLKO.1 417 CDS 100% 10.800 7.560 N Rasgef1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181318.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13290 pDONR223 100% 87.2% 97.4% None (many diffs) n/a
2 ccsbBroad304_13290 pLX_304 0% 87.2% 97.4% V5 (many diffs) n/a
3 TRCN0000467494 GTTCTTGGTGCAGCTCGATGCTAT pLX_317 30.5% 87.2% 97.4% V5 (many diffs) n/a
Download CSV