Transcript: Mouse NM_181328.3

Mus musculus solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29 (Slc25a29), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Slc25a29 (214663)
Length:
1964
CDS:
192..1112

Additional Resources:

NCBI RefSeq record:
NM_181328.3
NBCI Gene record:
Slc25a29 (214663)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181328.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079825 CTTCCTCACCTATGATGTAAT pLKO.1 695 CDS 100% 13.200 9.240 N Slc25a29 n/a
2 TRCN0000245275 GCGTCTACTTCCTCACCTATG pLKO_005 688 CDS 100% 6.000 4.200 N SLC25A29 n/a
3 TRCN0000079827 CAGTCACTGTGGTGCTTACAT pLKO.1 994 CDS 100% 5.625 3.938 N Slc25a29 n/a
4 TRCN0000079824 CTTCATCAATGCACTGGTGTT pLKO.1 401 CDS 100% 4.050 2.835 N Slc25a29 n/a
5 TRCN0000079823 GCCGTTCTTCAAATCCTCCAT pLKO.1 1394 3UTR 100% 2.640 1.848 N Slc25a29 n/a
6 TRCN0000079826 GTGGTTAAGTCACGACTGCAA pLKO.1 825 CDS 100% 2.640 1.848 N Slc25a29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181328.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13094 pDONR223 100% 64.3% 68.3% None (many diffs) n/a
2 ccsbBroad304_13094 pLX_304 0% 64.3% 68.3% V5 (many diffs) n/a
3 TRCN0000476991 TGTCGTGCTATGACCAACGATATA pLX_317 21.3% 64.3% 68.3% V5 (many diffs) n/a
Download CSV