Transcript: Mouse NM_181390.3

Mus musculus musculoskeletal, embryonic nuclear protein 1 (Mustn1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mustn1 (66175)
Length:
1194
CDS:
351..599

Additional Resources:

NCBI RefSeq record:
NM_181390.3
NBCI Gene record:
Mustn1 (66175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340129 GCCCTTGGAAACACCAATAAA pLKO_005 723 3UTR 100% 15.000 21.000 N Mustn1 n/a
2 TRCN0000193330 CATCAAGTCTAAGACATACCA pLKO.1 455 CDS 100% 3.000 4.200 N Mustn1 n/a
3 TRCN0000216855 GAAGATGGTGCCATAGCTAAA pLKO.1 985 3UTR 100% 10.800 8.640 N Mustn1 n/a
4 TRCN0000176115 GTCTAAGACATACCAGGTCAT pLKO.1 461 CDS 100% 4.050 3.240 N Mustn1 n/a
5 TRCN0000340056 GTCTAAGACATACCAGGTCAT pLKO_005 461 CDS 100% 4.050 3.240 N Mustn1 n/a
6 TRCN0000174939 GTTCTTCCTAAATCTCTGTTT pLKO.1 956 3UTR 100% 4.950 3.465 N Mustn1 n/a
7 TRCN0000176364 CAGGACATCAAGTCTAAGACA pLKO.1 450 CDS 100% 3.000 2.100 N Mustn1 n/a
8 TRCN0000340055 CAGGACATCAAGTCTAAGACA pLKO_005 450 CDS 100% 3.000 2.100 N Mustn1 n/a
9 TRCN0000176183 GCCATTTCTTTAGAGGACTCT pLKO.1 1013 3UTR 100% 2.640 1.848 N Mustn1 n/a
10 TRCN0000173847 CAGTCTTTGAGAAGCCCAAAG pLKO.1 550 CDS 100% 0.600 0.360 N Mustn1 n/a
11 TRCN0000340057 CAGTCTTTGAGAAGCCCAAAG pLKO_005 550 CDS 100% 0.600 0.360 N Mustn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05599 pDONR223 100% 85.3% 85.3% None (many diffs) n/a
2 ccsbBroad304_05599 pLX_304 0% 85.3% 85.3% V5 (many diffs) n/a
3 TRCN0000465881 TGAGTTATTATACCGCAGATCAAG pLX_317 100% 85.3% 85.3% V5 (many diffs) n/a
Download CSV