Transcript: Mouse NM_181406.3

Mus musculus arginyl-tRNA synthetase 2, mitochondrial (Rars2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rars2 (109093)
Length:
1880
CDS:
34..1770

Additional Resources:

NCBI RefSeq record:
NM_181406.3
NBCI Gene record:
Rars2 (109093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348551 ATCGCATGGACAAGTACAATT pLKO_005 1028 CDS 100% 13.200 18.480 N Rars2 n/a
2 TRCN0000075935 GCGGAGGGAAATGTTGTAGTA pLKO.1 910 CDS 100% 4.950 6.930 N Rars2 n/a
3 TRCN0000313920 CTTGCAGCTGTGGCACATAAA pLKO_005 1624 CDS 100% 13.200 9.240 N Rars2 n/a
4 TRCN0000348616 TGGCTGTAAATATGGGTTAAA pLKO_005 357 CDS 100% 13.200 9.240 N Rars2 n/a
5 TRCN0000313919 TAGCTACCTCCTAACTCTAAG pLKO_005 1599 CDS 100% 10.800 7.560 N Rars2 n/a
6 TRCN0000075934 CCTGTCAGCTTTCCAGAGTAT pLKO.1 62 CDS 100% 4.950 3.465 N Rars2 n/a
7 TRCN0000075936 GAGGGAAATGTTGTAGTAGAT pLKO.1 913 CDS 100% 4.950 3.465 N Rars2 n/a
8 TRCN0000317581 GAGGGAAATGTTGTAGTAGAT pLKO_005 913 CDS 100% 4.950 3.465 N Rars2 n/a
9 TRCN0000337603 CAGGTTTGATGAGGTACTTTA pLKO_005 1542 CDS 100% 13.200 7.920 N Rars2 n/a
10 TRCN0000075937 CAAAGGGCAAAGAAGGCATTT pLKO.1 1074 CDS 100% 10.800 6.480 N Rars2 n/a
11 TRCN0000075933 GCTTCCATTAAGACCACGAAA pLKO.1 1258 CDS 100% 4.950 2.970 N Rars2 n/a
12 TRCN0000317582 GCTTCCATTAAGACCACGAAA pLKO_005 1258 CDS 100% 4.950 2.970 N Rars2 n/a
13 TRCN0000413318 AGCTTTAGGACATCAAGTAAT pLKO_005 510 CDS 100% 13.200 18.480 N RARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08690 pDONR223 100% 85.9% 86.3% None (many diffs) n/a
2 ccsbBroad304_08690 pLX_304 0% 85.9% 86.3% V5 (many diffs) n/a
3 TRCN0000471206 CACCCTGGCCCGAGACGGTGGCAC pLX_317 26.5% 85.9% 86.3% V5 (many diffs) n/a
4 ccsbBroadEn_12325 pDONR223 100% 53.3% 50.3% None (many diffs) n/a
5 ccsbBroad304_12325 pLX_304 0% 53.3% 50.3% V5 (many diffs) n/a
6 TRCN0000467868 TCAAGAACTTATCCGTTACTCGCG pLX_317 36.3% 53.3% 50.3% V5 (many diffs) n/a
Download CSV