Construct: ORF TRCN0000467868
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005405.1_s317c1
- Derived from:
- ccsbBroadEn_12325
- DNA Barcode:
- TCAAGAACTTATCCGTTACTCGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RARS2 (57038)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467868
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XR_001743517.2 | 83.1% | (many diffs) | |
2 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XM_011535949.3 | 71.5% | 69.3% | 1035_1038delGACA;1082_1506del |
3 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_020320.5 | 62.1% | 60.2% | 1035_1038delGACA;1082_1734del |
4 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_001350505.1 | 61% | 59.1% | 1035_1038delGACA;1082_1764del |
5 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146756.1 | 46.8% | 1_75del;1110_1113delGACA;1157_2301del | |
6 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_134857.1 | 46.4% | 1_75del;1153_2318del | |
7 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146749.1 | 45.1% | 1_75del;110_330del;1374_2388del | |
8 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146743.1 | 42.9% | 1_75del;110_330del;1374_2507del | |
9 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146738.1 | 42.8% | (many diffs) | |
10 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146740.1 | 42.8% | (many diffs) | |
11 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146751.1 | 42.7% | (many diffs) | |
12 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146744.1 | 42.6% | (many diffs) | |
13 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146748.1 | 42.5% | (many diffs) | |
14 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146757.1 | 41% | (many diffs) | |
15 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146750.1 | 40.9% | (many diffs) | |
16 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146755.1 | 40.8% | (many diffs) | |
17 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146742.1 | 40.3% | (many diffs) | |
18 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146753.1 | 39.5% | (many diffs) | |
19 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146754.1 | 39.1% | (many diffs) | |
20 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146746.1 | 38.9% | (many diffs) | |
21 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146752.1 | 38.8% | (many diffs) | |
22 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146747.1 | 37.5% | (many diffs) | |
23 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146741.1 | 37.4% | (many diffs) | |
24 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146739.1 | 37.3% | (many diffs) | |
25 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146758.1 | 36% | (many diffs) | |
26 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146759.1 | 34.3% | (many diffs) | |
27 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NR_146745.1 | 34.2% | (many diffs) | |
28 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_001318785.1 | 31.8% | 29.9% | 0_1ins525;510_513delGACA;557_1209del |
29 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_001350507.1 | 31.8% | 29.9% | 0_1ins525;510_513delGACA;557_1209del |
30 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_001350508.1 | 31.8% | 29.9% | 0_1ins525;510_513delGACA;557_1209del |
31 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_001350509.1 | 31.8% | 29.9% | 0_1ins525;510_513delGACA;557_1209del |
32 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_001350510.1 | 31.8% | 29.9% | 0_1ins525;510_513delGACA;557_1209del |
33 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_001350511.1 | 31.8% | 29.9% | 0_1ins525;510_513delGACA;557_1209del |
34 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XM_024446494.1 | 31.8% | 29.9% | 0_1ins525;510_513delGACA;557_1209del |
35 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | NM_001350506.1 | 31.2% | 29.4% | 0_1ins525;510_513delGACA;557_1239del |
36 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XM_017011073.1 | 31.2% | 29.4% | 0_1ins525;510_513delGACA;557_1239del |
37 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XM_017011074.2 | 31.2% | 29.4% | 0_1ins525;510_513delGACA;557_1239del |
38 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XM_017011075.2 | 31.2% | 29.4% | 0_1ins525;510_513delGACA;557_1239del |
39 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XM_017011076.2 | 31.2% | 29.4% | 0_1ins525;510_513delGACA;557_1239del |
40 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XM_017011077.2 | 31.2% | 29.4% | 0_1ins525;510_513delGACA;557_1239del |
41 | human | 57038 | RARS2 | arginyl-tRNA synthetase 2, ... | XM_017011078.2 | 31.2% | 29.4% | 0_1ins525;510_513delGACA;557_1239del |
42 | mouse | 109093 | Rars2 | arginyl-tRNA synthetase 2, ... | NM_181406.3 | 53.3% | 50.3% | (many diffs) |
43 | mouse | 109093 | Rars2 | arginyl-tRNA synthetase 2, ... | XR_390310.3 | 49.1% | (many diffs) | |
44 | mouse | 109093 | Rars2 | arginyl-tRNA synthetase 2, ... | XM_006537548.3 | 18.9% | 16.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1143
- ORF length:
- 1077
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtgcggcttt cgccgcgcta ttgcttgcca gctttccaga gtgttgaatc 121 ttccaccaga aaacttgatc acatcaatat ctgcagttcc aatttcccaa aaagaagaag 181 tagctgattt tcagctttct gtggattctt tattggaaaa agacaatgac cattcaagac 241 cagatattca agttcaagcc aagagactag cagagaagct aagatgtgat acagtggtga 301 gtgaaatcag tactggtcaa aggactgtaa atttcaaaat aaacagagag ctcttaacaa 361 agacagtgct acaacaagta attgaagatg gctcaaaata tggattaaaa agtgaacttt 421 tctctggact tccccagaag aagattgtgg ttgaattcag ttcacctaat gttgccaaaa 481 aatttcatgt tggacatttg cgttctacca tcataggaaa ttttatagca aatctcaaag 541 aagctttagg acatcaagta ataagaataa attaccttgg cgattggggc atgcagtttg 601 gtcttctggg aactggcttc cagctgtttg gctatgagga aaaactgcag tccaatcctc 661 tacagcatct ctttgaagtt tatgtacaag ttaataaaga agcagcagat gataaaagtg 721 tagcaaaagc agcacaggag ttcttccaac gattGGAACT GGGCGATGTG CAAGCACTTT 781 CACTGTGGCA AAAATTTCGG GACTTGAGCA TTGAAGAGTA CATTCGGGTT TACAAGCGTC 841 TGGGAGTATA TTTTGATGAA TATTCAGGAG AATCATTTTA TCGTGAAAAA TCTCAAGAGG 901 TCTTAAAGTT GCTGGAGAGT AAAGGACTCC TACTGAAAAC AATAAAAGGA ACGGCTGTAG 961 TAGATCTCTC TGGGAATGGC GACCCCTCCT CAATTTGTAC TGTAATGCGA AGTGATGGGA 1021 CTTCTCTCTA TGCAACCAGA GATCTTGCAG CTGCTATAGA TCGAATGGAC AAGTATAATT 1081 TTGATACAAT GATATATGTG ATAAAGGACA AAAAAAGCAT TTTCAGCAAG TATTCCAAAT 1141 GCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1201 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1261 GGCTTTATAT ATCTTGTGGA AAGGACGATC AAGAACTTAT CCGTTACTCG CGACGCGTTA 1321 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt