Transcript: Human NM_181515.2

Homo sapiens mitochondrial ribosomal protein L21 (MRPL21), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MRPL21 (219927)
Length:
706
CDS:
291..653

Additional Resources:

NCBI RefSeq record:
NM_181515.2
NBCI Gene record:
MRPL21 (219927)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154567 GAAATGAACTAGACCTTGCGT pLKO.1 385 CDS 100% 0.750 0.600 N MRPL21 n/a
2 TRCN0000155631 CTGCTTCTCGAAGGTTCAATT pLKO.1 123 5UTR 100% 13.200 9.240 N MRPL21 n/a
3 TRCN0000154674 GACAGAATCATGGCCAAGAAT pLKO.1 524 CDS 100% 5.625 3.938 N MRPL21 n/a
4 TRCN0000158330 CGAGTAGAAGCCACAGTCATT pLKO.1 498 CDS 100% 4.950 3.465 N MRPL21 n/a
5 TRCN0000155574 CGTGAAGAAGGTGAATGAGAT pLKO.1 272 5UTR 100% 4.950 3.465 N MRPL21 n/a
6 TRCN0000151633 GAAGAAGGTGAATGAGATGAT pLKO.1 275 5UTR 100% 4.950 3.465 N MRPL21 n/a
7 TRCN0000157538 GACCTCTGAAGACCTGATCTT pLKO.1 359 CDS 100% 4.950 3.465 N MRPL21 n/a
8 TRCN0000157273 GAGGTCGTGAAGAAGGTGAAT pLKO.1 267 5UTR 100% 4.950 2.970 N MRPL21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181515.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09850 pDONR223 100% 57.4% 57.4% None 0_1ins267 n/a
2 ccsbBroad304_09850 pLX_304 0% 57.4% 57.4% V5 0_1ins267 n/a
3 TRCN0000465847 AGCCATCATACTTAGTTCCACCGC pLX_317 65% 57.4% 57.4% V5 0_1ins267 n/a
Download CSV