Transcript: Human NM_181573.2

Homo sapiens replication factor C subunit 4 (RFC4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
RFC4 (5984)
Length:
1486
CDS:
283..1374

Additional Resources:

NCBI RefSeq record:
NM_181573.2
NBCI Gene record:
RFC4 (5984)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074233 GCATCTGATGAACGTGGAATA pLKO.1 610 CDS 100% 10.800 15.120 N RFC4 n/a
2 TRCN0000331461 GCATCTGATGAACGTGGAATA pLKO_005 610 CDS 100% 10.800 15.120 N RFC4 n/a
3 TRCN0000074234 CCTGACCTCTAGATGTTCAAA pLKO.1 849 CDS 100% 5.625 3.938 N RFC4 n/a
4 TRCN0000300878 CCTGACCTCTAGATGTTCAAA pLKO_005 849 CDS 100% 5.625 3.938 N RFC4 n/a
5 TRCN0000074236 CAGAAGTCTATTATCACAGAA pLKO.1 1249 CDS 100% 4.950 3.465 N RFC4 n/a
6 TRCN0000300879 CAGAAGTCTATTATCACAGAA pLKO_005 1249 CDS 100% 4.950 3.465 N RFC4 n/a
7 TRCN0000074235 CCGATTCTGTCTTATCTGTAA pLKO.1 804 CDS 100% 4.950 3.465 N RFC4 n/a
8 TRCN0000300939 CCGATTCTGTCTTATCTGTAA pLKO_005 804 CDS 100% 4.950 3.465 N RFC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181573.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06857 pDONR223 100% 99.9% 100% None 798C>T n/a
2 ccsbBroad304_06857 pLX_304 0% 99.9% 100% V5 798C>T n/a
3 TRCN0000472875 CTCCCTATCTCTTAGGGTCGCCCT pLX_317 50.6% 99.9% 100% V5 798C>T n/a
Download CSV