Transcript: Human NM_181598.3

Homo sapiens atlastin GTPase 1 (ATL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ATL1 (51062)
Length:
2637
CDS:
242..1903

Additional Resources:

NCBI RefSeq record:
NM_181598.3
NBCI Gene record:
ATL1 (51062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181598.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118754 CCCAAATGACTTGCAGACCAA pLKO.1 1390 CDS 100% 2.640 2.112 N ATL1 n/a
2 TRCN0000248666 TGGAGTTTCCCATACGAATTT pLKO_005 896 CDS 100% 13.200 9.240 N Atl1 n/a
3 TRCN0000118755 GATCAGCTCAATACAGGTATA pLKO.1 748 CDS 100% 10.800 7.560 N ATL1 n/a
4 TRCN0000118752 GCTGGATTTAATCTGTATCAT pLKO.1 2329 3UTR 100% 5.625 3.938 N ATL1 n/a
5 TRCN0000118753 CCATTCCTGTTTCACCAACAT pLKO.1 1012 CDS 100% 4.950 3.465 N ATL1 n/a
6 TRCN0000118756 TCATTGTCAAAGATGACCATT pLKO.1 354 CDS 100% 4.950 3.465 N ATL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181598.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08206 pDONR223 100% 99% 99.1% None 351G>A;1549_1550insAGGGAAGTACAAATG n/a
2 ccsbBroad304_08206 pLX_304 0% 99% 99.1% V5 351G>A;1549_1550insAGGGAAGTACAAATG n/a
3 TRCN0000471303 CATCCCTTTATTGTTACCTACTGC pLX_317 25.5% 99% 99.1% V5 351G>A;1549_1550insAGGGAAGTACAAATG n/a
Download CSV