Transcript: Human NM_181746.3

Homo sapiens ceramide synthase 2 (CERS2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CERS2 (29956)
Length:
2544
CDS:
427..1569

Additional Resources:

NCBI RefSeq record:
NM_181746.3
NBCI Gene record:
CERS2 (29956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181746.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276341 ATGGCCGTCATTGTGGATAAA pLKO_005 877 CDS 100% 13.200 18.480 N CERS2 n/a
2 TRCN0000276378 CTGCGCTATAGGGTCACTTTA pLKO_005 1628 3UTR 100% 13.200 18.480 N CERS2 n/a
3 TRCN0000176056 GTGGATAAACCCTGGTTCTAT pLKO.1 889 CDS 100% 5.625 7.875 N Cers2 n/a
4 TRCN0000277403 GTGGATAAACCCTGGTTCTAT pLKO_005 889 CDS 100% 5.625 7.875 N Cers2 n/a
5 TRCN0000021749 CCTCAATAACAACCATCGTAA pLKO.1 1539 CDS 100% 4.950 6.930 N CERS2 n/a
6 TRCN0000276340 CAACGCCACCTTGGAACATTT pLKO_005 666 CDS 100% 13.200 9.240 N CERS2 n/a
7 TRCN0000276376 CCTGCCTTCTTTGGCTATTAC pLKO_005 1315 CDS 100% 13.200 9.240 N CERS2 n/a
8 TRCN0000021751 CCAGTATTGGTACTACATGAT pLKO.1 960 CDS 100% 4.950 3.465 N CERS2 n/a
9 TRCN0000021753 ACTCTAATCATGGCTCTGCAT pLKO.1 1123 CDS 100% 2.640 1.848 N CERS2 n/a
10 TRCN0000193773 CCCACAAGTTCATAACTGGAA pLKO.1 1406 CDS 100% 2.640 1.848 N Cers2 n/a
11 TRCN0000276339 TGGAGTCAGCCAAGATGTTTA pLKO_005 1163 CDS 100% 13.200 7.920 N CERS2 n/a
12 TRCN0000021750 CCACAAGTTCATAACTGGAAA pLKO.1 1407 CDS 100% 4.950 2.970 N CERS2 n/a
13 TRCN0000021752 GAAGAAAGTTTGGGAGGGATA pLKO.1 915 CDS 100% 4.050 2.430 N CERS2 n/a
14 TRCN0000217074 CTGCCTTCTTTGGCTATTATT pLKO.1 1316 CDS 100% 15.000 10.500 N Cers2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181746.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03117 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03117 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470088 GGCCTGAACTCGACCAAAAGGAGA pLX_317 42.5% 100% 100% V5 n/a
4 ccsbBroadEn_15809 pDONR223 0% 99.9% 100% None 669C>T n/a
5 ccsbBroad304_15809 pLX_304 0% 99.9% 100% V5 669C>T n/a
6 TRCN0000469810 GTAAGGTAAATATTGCAAGTTACA pLX_317 42.9% 99.9% 100% V5 669C>T n/a
Download CSV