Transcript: Human NM_181798.1

Homo sapiens potassium voltage-gated channel subfamily Q member 1 (KCNQ1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
KCNQ1 (3784)
Length:
3029
CDS:
257..1906

Additional Resources:

NCBI RefSeq record:
NM_181798.1
NBCI Gene record:
KCNQ1 (3784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265649 TGTCCACCATCGAGCAGTATG pLKO_005 300 CDS 100% 10.800 15.120 N KCNQ1 n/a
2 TRCN0000255610 TTCGACGCATGCAGTACTTTG pLKO_005 1425 CDS 100% 10.800 15.120 N KCNQ1 n/a
3 TRCN0000043960 GACGGCTATGACAGTTCTGTA pLKO.1 1250 CDS 100% 4.950 6.930 N KCNQ1 n/a
4 TRCN0000255607 TACGATGTGCGGGACGTCATT pLKO_005 1481 CDS 100% 4.950 6.930 N KCNQ1 n/a
5 TRCN0000255611 CATCGCATAGAAATCAATAAT pLKO_005 2780 3UTR 100% 15.000 10.500 N KCNQ1 n/a
6 TRCN0000255608 ATGAGTTTCACAGTGTGATTT pLKO_005 2827 3UTR 100% 13.200 9.240 N KCNQ1 n/a
7 TRCN0000255609 CAAGAAGTCTGTGGTGGTAAA pLKO_005 1111 CDS 100% 10.800 7.560 N KCNQ1 n/a
8 TRCN0000255612 TCATCTTCTCCTCGTACTTTG pLKO_005 693 CDS 100% 10.800 7.560 N KCNQ1 n/a
9 TRCN0000265661 CAACCTCATGGTGCGCATCAA pLKO_005 1525 CDS 100% 4.950 3.465 N KCNQ1 n/a
10 TRCN0000255605 CTCCACCTGGAAGATCTACAT pLKO_005 1042 CDS 100% 4.950 3.465 N KCNQ1 n/a
11 TRCN0000043961 GCTGATAACCACCCTGTACAT pLKO.1 658 CDS 100% 4.950 3.465 N KCNQ1 n/a
12 TRCN0000043959 GCCAAGAAGAAATTCCAGCAA pLKO.1 1448 CDS 100% 2.640 1.848 N KCNQ1 n/a
13 TRCN0000043962 GCTGGCACTCATCACCGACAT pLKO.1 1690 CDS 100% 1.350 0.945 N KCNQ1 n/a
14 TRCN0000255606 TCTTTGCCATCTCCTTCTTTG pLKO_005 876 CDS 100% 10.800 6.480 N KCNQ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00903 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00903 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479670 CAAGAGGGCTGTCGGTTGTTCTCG pLX_317 18.9% 100% 100% V5 n/a
Download CSV