Transcript: Human NM_181874.2

Homo sapiens glutamate metabotropic receptor 7 (GRM7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GRM7 (2917)
Length:
4239
CDS:
275..3043

Additional Resources:

NCBI RefSeq record:
NM_181874.2
NBCI Gene record:
GRM7 (2917)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009034 GCCACTTTCATCCGCTACAAT pLKO.1 2102 CDS 100% 5.625 7.875 N GRM7 n/a
2 TRCN0000009036 GCTCGAACAGTCGCTTACTTT pLKO.1 619 CDS 100% 5.625 7.875 N GRM7 n/a
3 TRCN0000242000 TTGCCAACGATGAGGATATAA pLKO_005 1131 CDS 100% 15.000 10.500 N Grm7 n/a
4 TRCN0000363191 TTGCCAACGATGAGGATATAA pLKO_005 1131 CDS 100% 15.000 10.500 N GRM7 n/a
5 TRCN0000367871 ATCGGATTTATCGCATATTTG pLKO_005 2307 CDS 100% 13.200 9.240 N GRM7 n/a
6 TRCN0000009033 CCTTACTTTATCTGGGCTTAA pLKO.1 3286 3UTR 100% 10.800 7.560 N GRM7 n/a
7 TRCN0000216447 GAATAGAGGTCTTGATCTTTG pLKO.1 3829 3UTR 100% 10.800 7.560 N Grm7 n/a
8 TRCN0000009035 CCAGACTCATAAGCCCAACAT pLKO.1 2355 CDS 100% 4.950 3.465 N GRM7 n/a
9 TRCN0000009037 CCCAGATTAGTTATGCATCAA pLKO.1 798 CDS 100% 4.950 3.465 N GRM7 n/a
10 TRCN0000363160 TACTTTATCTGGGCTTAATAA pLKO_005 3289 3UTR 100% 15.000 9.000 N GRM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489177 TACTAAGGTTGACAGGTACAGTCG pLX_317 12.2% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488421 CTTACATAACTAACCGCCTCGATA pLX_317 11.8% 98.4% 97.9% V5 (many diffs) n/a
3 TRCN0000489148 ACCAAGACACGGACTTCTGAAGGA pLX_317 15.8% 98.4% 97.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV