Transcript: Human NM_182503.3

Homo sapiens adenosine deaminase tRNA specific 2 (ADAT2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ADAT2 (134637)
Length:
6244
CDS:
38..613

Additional Resources:

NCBI RefSeq record:
NM_182503.3
NBCI Gene record:
ADAT2 (134637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421106 GTTGACATCGTTGAATCATAT pLKO_005 679 3UTR 100% 13.200 18.480 N ADAT2 n/a
2 TRCN0000050655 TCCTCGATTGGTGTCGTCAAA pLKO.1 276 CDS 100% 4.950 6.930 N ADAT2 n/a
3 TRCN0000050653 GCTGGTTGTATATGGCTGTCA pLKO.1 397 CDS 100% 2.640 3.696 N ADAT2 n/a
4 TRCN0000050656 GTTGTGGCTCTGTTCTAAATA pLKO.1 435 CDS 100% 15.000 12.000 N ADAT2 n/a
5 TRCN0000421218 ACTGTGGAGCCGTGCATTATG pLKO_005 344 CDS 100% 13.200 9.240 N ADAT2 n/a
6 TRCN0000434988 AGAGTCCCTCTGAAGTATTTG pLKO_005 303 CDS 100% 13.200 9.240 N ADAT2 n/a
7 TRCN0000413784 CTGACAATTGTAAACAGTTAT pLKO_005 786 3UTR 100% 13.200 9.240 N ADAT2 n/a
8 TRCN0000050654 TGGGAGACCATTTCAGTGTAT pLKO.1 481 CDS 100% 4.950 3.465 N ADAT2 n/a
9 TRCN0000050657 AGAATGAACGATTTGGTGGTT pLKO.1 417 CDS 100% 2.640 1.848 N ADAT2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3323 3UTR 100% 4.950 2.475 Y KAAG1 n/a
11 TRCN0000048571 GAAGTATTTGAACACACTGTT pLKO.1 314 CDS 100% 4.950 2.970 N LOC402687 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13181 pDONR223 100% 83.7% 83.7% None 1_93del n/a
2 ccsbBroad304_13181 pLX_304 0% 83.7% 83.7% V5 1_93del n/a
3 TRCN0000473522 ACCTGGATCCAGCGCTCGGTCCGC pLX_317 94.6% 83.7% 83.7% V5 1_93del n/a
Download CSV