Transcript: Human NM_182546.3

Homo sapiens V-set and transmembrane domain containing 2A (VSTM2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
VSTM2A (222008)
Length:
3122
CDS:
407..1117

Additional Resources:

NCBI RefSeq record:
NM_182546.3
NBCI Gene record:
VSTM2A (222008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182546.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129166 GAAAGTCCAAGGCAATGACAT pLKO.1 709 CDS 100% 4.950 6.930 N VSTM2A n/a
2 TRCN0000128947 CCACAAGCTTCAGATTTCCAA pLKO.1 733 CDS 100% 3.000 4.200 N VSTM2A n/a
3 TRCN0000373941 GGTGCTTTGCTTTAATCTAAA pLKO_005 1103 CDS 100% 13.200 9.240 N VSTM2A n/a
4 TRCN0000412679 GGTGCTTTGCTTTAATCTAAA pLKO_005 1103 CDS 100% 13.200 9.240 N Vstm2a n/a
5 TRCN0000373858 AGCTACAAGCCATGGACTTTC pLKO_005 1051 CDS 100% 10.800 7.560 N VSTM2A n/a
6 TRCN0000373860 AGGCCTATCTGAAAGTCAATG pLKO_005 834 CDS 100% 10.800 7.560 N VSTM2A n/a
7 TRCN0000435368 AGGCCTATCTGAAAGTCAATG pLKO_005 834 CDS 100% 10.800 7.560 N Vstm2a n/a
8 TRCN0000128755 CCCAAACAAAGTCCACAATCA pLKO.1 1019 CDS 100% 4.950 3.465 N VSTM2A n/a
9 TRCN0000190530 GTACAACAAGGGCTTTCTTCT pLKO.1 461 CDS 100% 4.950 3.465 N Vstm2a n/a
10 TRCN0000127586 CACAGTGAAAGTCCAAGGCAA pLKO.1 703 CDS 100% 2.640 1.848 N VSTM2A n/a
11 TRCN0000202259 GATAGCTACAAGCCATGGACT pLKO.1 1048 CDS 100% 2.640 1.848 N Vstm2a n/a
12 TRCN0000129730 CAGATTTCCAAAGTGAGGAAA pLKO.1 743 CDS 100% 0.495 0.347 N VSTM2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182546.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13431 pDONR223 100% 91.4% 87.3% None (many diffs) n/a
2 ccsbBroad304_13431 pLX_304 0% 91.4% 87.3% V5 (many diffs) n/a
3 TRCN0000473383 AAGTCGTGTGCAGTGTTGCCGGTC pLX_317 64.3% 91.4% 87.3% V5 (many diffs) n/a
Download CSV