Transcript: Human NM_182548.4

Homo sapiens LHFPL tetraspan subfamily member 5 (LHFPL5), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LHFPL5 (222662)
Length:
2084
CDS:
320..979

Additional Resources:

NCBI RefSeq record:
NM_182548.4
NBCI Gene record:
LHFPL5 (222662)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182548.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129898 GTGACCCACTTCAAAGATATT pLKO.1 1187 3UTR 100% 13.200 9.240 N LHFPL5 n/a
2 TRCN0000128692 CCATCAGAACTTGAATCCTTT pLKO.1 1667 3UTR 100% 4.950 3.465 N LHFPL5 n/a
3 TRCN0000131070 CCTTCAAGACTGCCATGTTCT pLKO.1 597 CDS 100% 4.950 3.465 N LHFPL5 n/a
4 TRCN0000127894 CTTCAAGACTGCCATGTTCTT pLKO.1 598 CDS 100% 4.950 3.465 N LHFPL5 n/a
5 TRCN0000131065 CATCATCTGCTTCAGCCTGTT pLKO.1 652 CDS 100% 4.050 2.430 N LHFPL5 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1404 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182548.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09884 pDONR223 100% 99.8% 100% None 648C>A n/a
2 ccsbBroad304_09884 pLX_304 0% 99.8% 100% V5 648C>A n/a
3 TRCN0000465705 CTCAGGCAAGTTTACGCTTGATTT pLX_317 50.3% 99.8% 100% V5 648C>A n/a
Download CSV