Transcript: Human NM_182551.5

Homo sapiens lysocardiolipin acyltransferase 1 (LCLAT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
LCLAT1 (253558)
Length:
5071
CDS:
221..1465

Additional Resources:

NCBI RefSeq record:
NM_182551.5
NBCI Gene record:
LCLAT1 (253558)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182551.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436168 GAATTGCCTGATGCGATATAG pLKO_005 619 CDS 100% 13.200 18.480 N LCLAT1 n/a
2 TRCN0000418692 CACGTCCACCGGTATCCAATA pLKO_005 1070 CDS 100% 10.800 15.120 N LCLAT1 n/a
3 TRCN0000035853 TGGTCAATTAACGAGGCAGTT pLKO.1 263 CDS 100% 4.050 5.670 N LCLAT1 n/a
4 TRCN0000035852 CAGTCTTGTTAAGTGGTATTT pLKO.1 1321 CDS 100% 13.200 10.560 N LCLAT1 n/a
5 TRCN0000035850 GTGGTCAAATTGCTCTCTATA pLKO.1 1250 CDS 100% 13.200 9.240 N LCLAT1 n/a
6 TRCN0000428701 TGGCGTATCCTCACAACATTC pLKO_005 996 CDS 100% 10.800 7.560 N LCLAT1 n/a
7 TRCN0000035849 GCTGCCTATATCTTCATTCAT pLKO.1 716 CDS 100% 5.625 3.938 N LCLAT1 n/a
8 TRCN0000035851 GCTTTGGAATCATGGTGTCAT pLKO.1 324 CDS 100% 4.950 3.465 N LCLAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182551.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15294 pDONR223 93.4% 99.5% 99.5% None 22_24delATTinsGGA;108_109delTGinsCA;1179C>T n/a
2 ccsbBroad304_15294 pLX_304 0% 99.5% 99.5% V5 22_24delATTinsGGA;108_109delTGinsCA;1179C>T n/a
3 TRCN0000476513 TACTAGGCTGACTGCGAATCGGAA pLX_317 28% 99.5% 99.5% V5 22_24delATTinsGGA;108_109delTGinsCA;1179C>T n/a
4 ccsbBroadEn_14448 pDONR223 100% 90.4% 1.9% None (many diffs) n/a
5 ccsbBroad304_14448 pLX_304 0% 90.4% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000476914 CTTGCTTTATGTCATTGCACTATC pLX_317 32.6% 90.4% 1.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV