Transcript: Human NM_182606.4

Homo sapiens transmembrane serine protease 11A (TMPRSS11A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TMPRSS11A (339967)
Length:
3313
CDS:
101..1366

Additional Resources:

NCBI RefSeq record:
NM_182606.4
NBCI Gene record:
TMPRSS11A (339967)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182606.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046803 CCTGGTTCACTTCCTAGTATT pLKO.1 211 CDS 100% 13.200 18.480 N TMPRSS11A n/a
2 TRCN0000046807 GCCTCATCAGTTCAAGTTAAT pLKO.1 569 CDS 100% 13.200 10.560 N TMPRSS11A n/a
3 TRCN0000046805 GATCTGAAAGATACGTGGTAT pLKO.1 1235 CDS 100% 4.950 3.960 N TMPRSS11A n/a
4 TRCN0000428958 AGCTGTATGCAGGTCATATAT pLKO_005 1392 3UTR 100% 15.000 10.500 N TMPRSS11A n/a
5 TRCN0000046806 CACAGGTGTATGGCAATGATA pLKO.1 1128 CDS 100% 5.625 3.938 N TMPRSS11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182606.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10020 pDONR223 100% 99% 99% None (many diffs) n/a
2 ccsbBroad304_10020 pLX_304 0% 99% 99% V5 (many diffs) n/a
3 TRCN0000479098 GGCGTATGGGAGTCACTGGATCAA pLX_317 33.7% 99% 99% V5 (many diffs) n/a
Download CSV