Transcript: Human NM_182662.1

Homo sapiens aminoadipate aminotransferase (AADAT), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
AADAT (51166)
Length:
2108
CDS:
125..1402

Additional Resources:

NCBI RefSeq record:
NM_182662.1
NBCI Gene record:
AADAT (51166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035054 CCGGACCATGACTGACATATT pLKO.1 181 CDS 100% 13.200 18.480 N AADAT n/a
2 TRCN0000291245 CCGGACCATGACTGACATATT pLKO_005 181 CDS 100% 13.200 18.480 N AADAT n/a
3 TRCN0000035055 CCAGGTATTAGCACAACTTAT pLKO.1 1366 CDS 100% 13.200 9.240 N AADAT n/a
4 TRCN0000291300 CCAGGTATTAGCACAACTTAT pLKO_005 1366 CDS 100% 13.200 9.240 N AADAT n/a
5 TRCN0000035056 CCCTTAATAGAGAGAGTTATT pLKO.1 959 CDS 100% 13.200 9.240 N AADAT n/a
6 TRCN0000307657 CCCTTAATAGAGAGAGTTATT pLKO_005 959 CDS 100% 13.200 9.240 N AADAT n/a
7 TRCN0000035058 GCCAGTGATGAAAGTGGGATT pLKO.1 602 CDS 100% 4.050 2.835 N AADAT n/a
8 TRCN0000307661 GCCAGTGATGAAAGTGGGATT pLKO_005 602 CDS 100% 4.050 2.835 N AADAT n/a
9 TRCN0000035057 CCCTTACTTGAGAGCATCCTT pLKO.1 1309 CDS 100% 3.000 2.100 N AADAT n/a
10 TRCN0000291301 CCCTTACTTGAGAGCATCCTT pLKO_005 1309 CDS 100% 3.000 2.100 N AADAT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182662.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492234 GTCATGTGGGACACTTACTGTTTA pLX_317 26% 100% 100% V5 (not translated due to prior stop codon) n/a
2 ccsbBroadEn_14139 pDONR223 100% 98.9% 97.9% None 67_68insGTGAGAAACGGG;308C>A;1267delG n/a
3 ccsbBroad304_14139 pLX_304 0% 98.9% 97.9% V5 (not translated due to frame shift) 67_68insGTGAGAAACGGG;308C>A;1267delG n/a
Download CSV