Transcript: Human NM_182728.3

Homo sapiens solute carrier family 7 member 8 (SLC7A8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
SLC7A8 (23428)
Length:
3117
CDS:
237..1235

Additional Resources:

NCBI RefSeq record:
NM_182728.3
NBCI Gene record:
SLC7A8 (23428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043095 GCCCAAGTGTTTCAGTGACTT pLKO.1 1043 CDS 100% 4.950 6.930 N SLC7A8 n/a
2 TRCN0000043094 CCTGTCTATTTCCTGGGTGTT pLKO.1 1008 CDS 100% 4.050 3.240 N SLC7A8 n/a
3 TRCN0000043093 CCATCTTCTTATTCCCTCTTT pLKO.1 2851 3UTR 100% 4.950 3.465 N SLC7A8 n/a
4 TRCN0000043096 GCATTTGAGAATTTCCAGGAA pLKO.1 291 CDS 100% 2.640 1.848 N SLC7A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182728.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07883 pDONR223 100% 61.9% 62% None 0_1ins609;537C>T;561T>C n/a
2 ccsbBroad304_07883 pLX_304 0% 61.9% 62% V5 0_1ins609;537C>T;561T>C n/a
3 TRCN0000470617 TAGCAAGCAGGAAAACACGAAGGC pLX_317 22.7% 61.9% 62% V5 0_1ins609;537C>T;561T>C n/a
4 TRCN0000492299 TTCTAATTTCTGACTATTCGACAA pLX_317 13.1% 61.9% 62% V5 (not translated due to prior stop codon) 0_1ins609;537C>T;561T>C n/a
Download CSV