Transcript: Human NM_182894.3

Homo sapiens visual system homeobox 2 (VSX2), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
VSX2 (338917)
Length:
3018
CDS:
114..1199

Additional Resources:

NCBI RefSeq record:
NM_182894.3
NBCI Gene record:
VSX2 (338917)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182894.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412561 AGACATCCCTCATCTAGTCTT pLKO_005 1382 3UTR 100% 4.950 6.930 N VSX2 n/a
2 TRCN0000432558 ATGTCCAAATCTGCTTTAAAC pLKO_005 516 CDS 100% 13.200 9.240 N VSX2 n/a
3 TRCN0000420096 CTAAAGCCCATTGCTGCAAAT pLKO_005 1573 3UTR 100% 10.800 7.560 N VSX2 n/a
4 TRCN0000018063 GCTCGGATTCTGAAGATGTTT pLKO.1 478 CDS 100% 5.625 3.938 N VSX2 n/a
5 TRCN0000422654 AGCAGTGTCATGGCGGAGTAT pLKO_005 750 CDS 100% 4.950 3.465 N VSX2 n/a
6 TRCN0000419422 GCATTCAACGAAGCCCACTAC pLKO_005 609 CDS 100% 4.050 2.835 N VSX2 n/a
7 TRCN0000018066 GAAGATGTTTCCTCCAGCGAT pLKO.1 489 CDS 100% 2.640 1.848 N VSX2 n/a
8 TRCN0000070542 CCTGCCCAAGCTCGACAAGAT pLKO.1 941 CDS 100% 1.650 1.155 N Vsx2 n/a
9 TRCN0000018065 GCTCAGGAGCACAGCACCAAA pLKO.1 1050 CDS 100% 1.650 1.155 N VSX2 n/a
10 TRCN0000018067 CCCGAGTCCATCCTCAAGTCA pLKO.1 810 CDS 100% 1.000 0.700 N VSX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182894.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10006 pDONR223 100% 99.9% 100% None 471C>T n/a
2 ccsbBroad304_10006 pLX_304 0% 99.9% 100% V5 471C>T n/a
3 TRCN0000476663 TAGTCTTAGCACCTTTACGATAAT pLX_317 38.9% 99.9% 100% V5 471C>T n/a
Download CSV