Transcript: Mouse NM_183017.2

Mus musculus tubulin tyrosine ligase-like family, member 12 (Ttll12), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Mus musculus (mouse)
Gene:
Ttll12 (223723)
Length:
3770
CDS:
48..1967

Additional Resources:

NCBI RefSeq record:
NM_183017.2
NBCI Gene record:
Ttll12 (223723)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250921 ACAACCTCCACAGTATCATTC pLKO_005 1330 CDS 100% 10.800 15.120 N Ttll12 n/a
2 TRCN0000250920 CTGAAGCAGGTGCACTATAAT pLKO_005 1599 CDS 100% 15.000 10.500 N Ttll12 n/a
3 TRCN0000250922 CAGAGCCTTGGCCTAAGTTAT pLKO_005 2100 3UTR 100% 13.200 9.240 N Ttll12 n/a
4 TRCN0000265285 GGTACATCATGGACGAGTTTG pLKO_005 604 CDS 100% 10.800 7.560 N Ttll12 n/a
5 TRCN0000265313 TCGATGACCTAGACGACTATG pLKO_005 1537 CDS 100% 10.800 7.560 N Ttll12 n/a
6 TRCN0000176616 CTCATTCTTCAATGATGTCTT pLKO.1 1892 CDS 100% 0.495 0.347 N Ttll12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183017.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02727 pDONR223 100% 85.2% 85.4% None (many diffs) n/a
2 ccsbBroad304_02727 pLX_304 0% 85.2% 85.4% V5 (many diffs) n/a
3 TRCN0000479302 AACGACAATTACGGTTAGGACTAA pLX_317 21.6% 85.2% 85.4% V5 (many diffs) n/a
Download CSV