Transcript: Mouse NM_183029.2

Mus musculus insulin-like growth factor 2 mRNA binding protein 2 (Igf2bp2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Igf2bp2 (319765)
Length:
3902
CDS:
337..2115

Additional Resources:

NCBI RefSeq record:
NM_183029.2
NBCI Gene record:
Igf2bp2 (319765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255460 ATCGAGACCCTCTCGGGTAAA pLKO_005 499 CDS 100% 10.800 15.120 N IGF2BP2 n/a
2 TRCN0000096763 CCTCTCGGGTAAAGTGGAATT pLKO.1 507 CDS 100% 0.000 0.000 N Igf2bp2 n/a
3 TRCN0000096762 CTTGCAGGATTTGAGCATTTA pLKO.1 1251 CDS 100% 13.200 10.560 N Igf2bp2 n/a
4 TRCN0000255468 GTTGGCCCAGGGCGTTAAATT pLKO_005 3367 3UTR 100% 15.000 10.500 N IGF2BP2 n/a
5 TRCN0000096760 GCCGCATGATTCTTGAGATTA pLKO.1 1079 CDS 100% 13.200 9.240 N Igf2bp2 n/a
6 TRCN0000316219 GCCGCATGATTCTTGAGATTA pLKO_005 1079 CDS 100% 13.200 9.240 N Igf2bp2 n/a
7 TRCN0000255466 TCAGGCCAGACAGATTGATTT pLKO_005 876 CDS 100% 13.200 9.240 N IGF2BP2 n/a
8 TRCN0000304729 CCGTTGTCAACGTCACCTATA pLKO_005 698 CDS 100% 10.800 7.560 N Igf2bp2 n/a
9 TRCN0000096761 CCTTGCAGGATTTGAGCATTT pLKO.1 1250 CDS 100% 10.800 7.560 N Igf2bp2 n/a
10 TRCN0000316286 CCTTGCAGGATTTGAGCATTT pLKO_005 1250 CDS 100% 10.800 7.560 N Igf2bp2 n/a
11 TRCN0000255464 CTGAAGCATGCCGCATGATTC pLKO_005 1070 CDS 100% 10.800 7.560 N IGF2BP2 n/a
12 TRCN0000375386 CTGTACCCTCATCACCATTTC pLKO_005 1540 CDS 100% 10.800 7.560 N Igf2bp2 n/a
13 TRCN0000096759 GCCGTTTCTTTGTTGTGGAAA pLKO.1 2467 3UTR 100% 4.950 3.465 N Igf2bp2 n/a
14 TRCN0000316207 GCCGTTTCTTTGTTGTGGAAA pLKO_005 2467 3UTR 100% 4.950 3.465 N Igf2bp2 n/a
15 TRCN0000148565 CGGATCTTTGGGAAACTGAAA pLKO.1 1786 CDS 100% 4.950 3.960 N IGF2BP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183029.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10208 pDONR223 100% 89.7% 94.4% None (many diffs) n/a
2 ccsbBroad304_10208 pLX_304 0% 89.7% 94.4% V5 (many diffs) n/a
3 TRCN0000469479 CACTGCACGGTTCACGCTGAGAAA pLX_317 22.8% 89.7% 94.4% V5 (many diffs) n/a
Download CSV