Transcript: Mouse NM_183144.3

Mus musculus inositol polyphosphate-5-phosphatase A (Inpp5a), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Inpp5a (212111)
Length:
2792
CDS:
282..1550

Additional Resources:

NCBI RefSeq record:
NM_183144.3
NBCI Gene record:
Inpp5a (212111)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183144.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349975 TACGACCACATCGGGCCTAAT pLKO_005 1398 CDS 100% 10.800 15.120 N Inpp5a n/a
2 TRCN0000349916 CTACTTTGTCTTCGGTGATTT pLKO_005 959 CDS 100% 13.200 9.240 N Inpp5a n/a
3 TRCN0000313576 TCACTGGCAAGGAGATCTATT pLKO_005 670 CDS 100% 13.200 9.240 N Inpp5a n/a
4 TRCN0000081199 GCCTTCGACTTGGTGAACATT pLKO.1 810 CDS 100% 5.625 3.938 N Inpp5a n/a
5 TRCN0000349512 GCCTTCGACTTGGTGAACATT pLKO_005 810 CDS 100% 5.625 3.938 N Inpp5a n/a
6 TRCN0000081200 CCAGGGAGAACAGTACATGAA pLKO.1 1283 CDS 100% 4.950 3.465 N Inpp5a n/a
7 TRCN0000081201 CCAGTTTGACTTTAAAGCTAA pLKO.1 635 CDS 100% 4.950 3.465 N Inpp5a n/a
8 TRCN0000081202 CCATGTGGACAAATTTGTCAA pLKO.1 479 CDS 100% 4.950 3.465 N Inpp5a n/a
9 TRCN0000081198 GCTGAATATACTTTCCAGTAT pLKO.1 2025 3UTR 100% 0.495 0.347 N Inpp5a n/a
10 TRCN0000317119 GCTGAATATACTTTCCAGTAT pLKO_005 2025 3UTR 100% 0.495 0.347 N Inpp5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183144.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00875 pDONR223 100% 86.3% 90.4% None (many diffs) n/a
2 ccsbBroad304_00875 pLX_304 0% 86.3% 90.4% V5 (many diffs) n/a
3 TRCN0000468169 ATACCACTGAGCTATACTGATATG pLX_317 35.2% 86.3% 90.4% V5 (many diffs) n/a
Download CSV