Transcript: Mouse NM_183178.2

Mus musculus fibronectin type 3 and SPRY domain-containing protein (Fsd1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fsd1 (240121)
Length:
1748
CDS:
129..1619

Additional Resources:

NCBI RefSeq record:
NM_183178.2
NBCI Gene record:
Fsd1 (240121)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433899 CCTTCCGACTATCGCTCAAAG pLKO_005 514 CDS 100% 10.800 15.120 N Fsd1 n/a
2 TRCN0000098184 CGGGTCCACATCTCACCAGAA pLKO.1 947 CDS 100% 1.350 1.890 N Fsd1 n/a
3 TRCN0000098183 CGACAATATGAGTCACCTCAT pLKO.1 545 CDS 100% 0.405 0.567 N Fsd1 n/a
4 TRCN0000445434 GGAGTACCGCAAGACCAATTT pLKO_005 728 CDS 100% 13.200 9.240 N Fsd1 n/a
5 TRCN0000437142 GTGCCACTAGCAGTTCCAATA pLKO_005 1585 CDS 100% 10.800 7.560 N Fsd1 n/a
6 TRCN0000098181 GCCGCCAAGGAAATCAAAGAT pLKO.1 474 CDS 100% 5.625 3.938 N Fsd1 n/a
7 TRCN0000098182 GACAGCAAGATCGACCACTAT pLKO.1 702 CDS 100% 4.950 3.465 N Fsd1 n/a
8 TRCN0000098180 CCAGGCCATCTACCAGCTGGG pLKO.1 1621 3UTR 100% 0.000 0.000 N Fsd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183178.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12557 pDONR223 100% 54.9% 58.4% None (many diffs) n/a
2 ccsbBroad304_12557 pLX_304 0% 54.9% 58.4% V5 (many diffs) n/a
3 TRCN0000471389 AGCTGGATCATAGTTCCGTCGTGC pLX_317 49.9% 54.9% 58.4% V5 (many diffs) n/a
Download CSV