Transcript: Mouse NM_183180.2

Mus musculus tetraspanin 18 (Tspan18), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tspan18 (241556)
Length:
3773
CDS:
390..1136

Additional Resources:

NCBI RefSeq record:
NM_183180.2
NBCI Gene record:
Tspan18 (241556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_183180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094690 GCGATAACGATACGGATGTTT pLKO.1 769 CDS 100% 5.625 7.875 N Tspan18 n/a
2 TRCN0000094689 CCCAGACTAATAGGTTCACAA pLKO.1 2222 3UTR 100% 4.950 6.930 N Tspan18 n/a
3 TRCN0000381213 CCAGAAGCATAGAGCTAATTT pLKO_005 1238 3UTR 100% 15.000 10.500 N Tspan18 n/a
4 TRCN0000379995 ATTCAGTCATGATCACATTTG pLKO_005 805 CDS 100% 10.800 7.560 N Tspan18 n/a
5 TRCN0000380179 CAAGCACTACCAAGGCGATAA pLKO_005 755 CDS 100% 10.800 7.560 N Tspan18 n/a
6 TRCN0000094693 GAACAGGTGTCTGCTGCTATT pLKO.1 626 CDS 100% 10.800 7.560 N Tspan18 n/a
7 TRCN0000379719 GAGCAACCAGGAGGTAGAAAC pLKO_005 1470 3UTR 100% 10.800 7.560 N Tspan18 n/a
8 TRCN0000094691 GCCATTGGAGTACTGGCTATT pLKO.1 1065 CDS 100% 10.800 7.560 N Tspan18 n/a
9 TRCN0000379575 GGATCACCTCTCTTAGCATTT pLKO_005 1440 3UTR 100% 10.800 7.560 N Tspan18 n/a
10 TRCN0000094692 GCTTCCGAGAAATCGTGGCTA pLKO.1 508 CDS 100% 2.640 1.848 N Tspan18 n/a
11 TRCN0000381992 AGCCATCCTGGCCTTCATCTT pLKO_005 692 CDS 100% 4.950 2.970 N TSPAN18 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2263 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12933 pDONR223 100% 79.8% 79.8% None (many diffs) n/a
2 ccsbBroad304_12933 pLX_304 0% 79.8% 79.8% V5 (many diffs) n/a
3 TRCN0000479662 ATGCGTACCTCTTTGCTGCATACC pLX_317 50.3% 79.8% 79.8% V5 (many diffs) n/a
Download CSV