Transcript: Human NM_194294.2

Homo sapiens indoleamine 2,3-dioxygenase 2 (IDO2), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
IDO2 (169355)
Length:
2294
CDS:
243..1505

Additional Resources:

NCBI RefSeq record:
NM_194294.2
NBCI Gene record:
IDO2 (169355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158459 CGCAGTTATGAGCTTTCTTAA pLKO.1 1436 CDS 100% 13.200 9.240 N IDO2 n/a
2 TRCN0000160649 CTTTGGAAAGCTATCACATAT pLKO.1 325 CDS 100% 13.200 9.240 N IDO2 n/a
3 TRCN0000160692 CCGCAGTTATGAGCTTTCTTA pLKO.1 1435 CDS 100% 5.625 3.938 N IDO2 n/a
4 TRCN0000159505 CCATTGTCTTTGGAAAGCTAT pLKO.1 318 CDS 100% 4.950 3.465 N IDO2 n/a
5 TRCN0000163747 CCTGGGATAAAGGCTCTTGTT pLKO.1 819 CDS 100% 4.950 3.465 N IDO2 n/a
6 TRCN0000158599 CTTCTTCCAGATTCTCTGAAA pLKO.1 363 CDS 100% 4.950 3.465 N IDO2 n/a
7 TRCN0000159801 GAAAGCTATCACATATCTGAA pLKO.1 330 CDS 100% 4.950 3.465 N IDO2 n/a
8 TRCN0000163251 GCTTCAAGCTCATGTGGACAA pLKO.1 455 CDS 100% 4.050 2.835 N IDO2 n/a
9 TRCN0000164451 CAAGGAATCTTGCCCTTCCAT pLKO.1 604 CDS 100% 3.000 2.100 N IDO2 n/a
10 TRCN0000163573 GCAGTGCCATTGTCTTTGGAA pLKO.1 312 CDS 100% 3.000 2.100 N IDO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194294.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13353 pDONR223 100% 39.8% 39% None (many diffs) n/a
2 ccsbBroad304_13353 pLX_304 0% 39.8% 39% V5 (many diffs) n/a
3 TRCN0000479911 GATCACCTCGCTCCAGTCACGTTT pLX_317 75.8% 39.8% 39% V5 (many diffs) n/a
Download CSV