Transcript: Human NM_194328.2

Homo sapiens ring finger protein 38 (RNF38), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
RNF38 (152006)
Length:
5268
CDS:
608..1906

Additional Resources:

NCBI RefSeq record:
NM_194328.2
NBCI Gene record:
RNF38 (152006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431291 CAAATCGTACTTGCCCAATTT pLKO_005 1845 CDS 100% 13.200 18.480 N RNF38 n/a
2 TRCN0000435934 GATCGTCTGTCTCGACATAAT pLKO_005 746 CDS 100% 13.200 18.480 N RNF38 n/a
3 TRCN0000426924 TGAGTCAAGGCAGCTACTTAG pLKO_005 1768 CDS 100% 10.800 15.120 N RNF38 n/a
4 TRCN0000004621 TCCAGAGTGAAGATAGTCCAA pLKO.1 516 5UTR 100% 2.640 3.696 N RNF38 n/a
5 TRCN0000004622 AGTACCTTATCCTCCATTTAT pLKO.1 1426 CDS 100% 15.000 10.500 N RNF38 n/a
6 TRCN0000424373 CAACCTAAGAAGCACAAATTT pLKO_005 1908 3UTR 100% 15.000 10.500 N RNF38 n/a
7 TRCN0000427191 GACTGACTAAAGCAGATATTG pLKO_005 1668 CDS 100% 13.200 9.240 N RNF38 n/a
8 TRCN0000041002 GCCATCCTAACAAGGTGATTT pLKO.1 405 5UTR 100% 13.200 9.240 N Rnf38 n/a
9 TRCN0000428659 GCCATCCTAACAAGGTGATTT pLKO_005 405 5UTR 100% 13.200 9.240 N RNF38 n/a
10 TRCN0000429531 GCGTATGACTGTTGGTGATAA pLKO_005 2318 3UTR 100% 13.200 9.240 N RNF38 n/a
11 TRCN0000311188 CAGCACTTACCAGTACCATAT pLKO_005 1118 CDS 100% 10.800 7.560 N Rnf38 n/a
12 TRCN0000413006 TACGCACAGCAGCAAGCAATA pLKO_005 803 CDS 100% 10.800 7.560 N RNF38 n/a
13 TRCN0000004619 CCTTATTTCTAGTGATCCATT pLKO.1 1153 CDS 100% 4.950 3.465 N RNF38 n/a
14 TRCN0000040999 CGACATAATTCCATTAGTCAA pLKO.1 758 CDS 100% 4.950 3.465 N Rnf38 n/a
15 TRCN0000302739 CGACATAATTCCATTAGTCAA pLKO_005 758 CDS 100% 4.950 3.465 N Rnf38 n/a
16 TRCN0000004623 CTTCCTTCTTATCGGTTCAAT pLKO.1 1694 CDS 100% 5.625 3.375 N RNF38 n/a
17 TRCN0000004620 CAATGTATAATCTGGTGTGTT pLKO.1 2454 3UTR 100% 4.950 2.970 N RNF38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05061 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05061 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480062 TGCATCGCAGAGCTACCTAGCGTC pLX_317 27.1% 100% 100% V5 n/a
Download CSV