Transcript: Mouse NM_194335.2

Mus musculus nuclear apoptosis inducing factor 1 (Naif1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Naif1 (71254)
Length:
3173
CDS:
1983..2966

Additional Resources:

NCBI RefSeq record:
NM_194335.2
NBCI Gene record:
Naif1 (71254)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_194335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202188 CCGACGCTACCTACAGAATAA pLKO.1 2870 CDS 100% 13.200 18.480 N Naif1 n/a
2 TRCN0000190807 GTGATTGAAGGACACGTCTAT pLKO.1 2995 3UTR 100% 4.950 3.465 N Naif1 n/a
3 TRCN0000189891 CCAGACACATCTGTCAAACCA pLKO.1 2607 CDS 100% 3.000 2.100 N Naif1 n/a
4 TRCN0000202110 CTGGTGAACCACTTCAATGCT pLKO.1 2073 CDS 100% 3.000 2.100 N Naif1 n/a
5 TRCN0000202236 CCGAAGTCAAGAAGAAGTGGT pLKO.1 2179 CDS 100% 2.640 1.848 N Naif1 n/a
6 TRCN0000202135 CTGCTGGTGAACCACTTCAAT pLKO.1 2070 CDS 100% 5.625 3.375 N Naif1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14431 pDONR223 100% 46.3% 49.5% None (many diffs) n/a
2 ccsbBroad304_14431 pLX_304 0% 46.3% 49.5% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000470150 TAAAGTTAAGTTTTGGACCTCCCC pLX_317 69.5% 46.3% 49.5% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV