Transcript: Human NM_194439.4

Homo sapiens ring finger protein 212 (RNF212), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-10-26
Taxon:
Homo sapiens (human)
Gene:
RNF212 (285498)
Length:
2367
CDS:
101..799

Additional Resources:

NCBI RefSeq record:
NM_194439.4
NBCI Gene record:
RNF212 (285498)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_194439.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413056 GAGATTGTTAGCCTTCTATAG pLKO_005 376 CDS 100% 10.800 15.120 N RNF212 n/a
2 TRCN0000073247 TCAAAGCATACCGACGCAGAT pLKO.1 263 CDS 100% 4.050 5.670 N RNF212 n/a
3 TRCN0000073243 CGAATGTTCTATGGGTTTGAA pLKO.1 1447 3UTR 100% 5.625 4.500 N RNF212 n/a
4 TRCN0000073245 GCTTGATTTGTAAAGCTCCTT pLKO.1 225 CDS 100% 2.640 2.112 N RNF212 n/a
5 TRCN0000434632 ATCTCTCTCCTTCTCCGATTA pLKO_005 585 CDS 100% 10.800 7.560 N RNF212 n/a
6 TRCN0000073244 CCTGCGAGAATCTCCATGATT pLKO.1 629 CDS 100% 5.625 3.938 N RNF212 n/a
7 TRCN0000073246 CCAGGCATTCTTCATGAGCAT pLKO.1 286 CDS 100% 2.640 1.848 N RNF212 n/a
8 TRCN0000428888 GCAGATAGAACAACTACAAAG pLKO_005 442 CDS 100% 10.800 6.480 N RNF212 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_194439.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05398 pDONR223 100% 78.1% 65.9% None 573_574ins53;696_697ins142 n/a
2 ccsbBroad304_05398 pLX_304 0% 78.1% 65.9% V5 573_574ins53;696_697ins142 n/a
3 ccsbBroadEn_13551 pDONR223 100% 54.7% 33.4% None (many diffs) n/a
4 ccsbBroad304_13551 pLX_304 0% 54.7% 33.4% V5 (many diffs) n/a
5 TRCN0000480141 CGGACAGCCAGTTTCAGTTCGCGG pLX_317 43.9% 54.7% 33.4% V5 (many diffs) n/a
Download CSV