Transcript: Human NM_197966.2

Homo sapiens BH3 interacting domain death agonist (BID), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
BID (637)
Length:
2535
CDS:
354..1079

Additional Resources:

NCBI RefSeq record:
NM_197966.2
NBCI Gene record:
BID (637)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_197966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062709 CTTTCACACAACAGTGAATTT pLKO.1 1001 CDS 100% 1.320 1.056 N BID n/a
2 TRCN0000327897 CTTTCACACAACAGTGAATTT pLKO_005 1001 CDS 100% 1.320 1.056 N BID n/a
3 TRCN0000312746 GAAGACATCATCCGGAATATT pLKO_005 729 CDS 100% 15.000 10.500 N BID n/a
4 TRCN0000312688 ATGTCCATTTACACGTATTTG pLKO_005 1281 3UTR 100% 13.200 9.240 N BID n/a
5 TRCN0000062711 GTGAGGAGCTTAGCCAGAAAT pLKO.1 1047 CDS 100% 13.200 9.240 N BID n/a
6 TRCN0000327898 GTGAGGAGCTTAGCCAGAAAT pLKO_005 1047 CDS 100% 13.200 9.240 N BID n/a
7 TRCN0000062712 CAGGGATGAGTGCATCACAAA pLKO.1 524 CDS 100% 4.950 3.465 N BID n/a
8 TRCN0000327896 CAGGGATGAGTGCATCACAAA pLKO_005 524 CDS 100% 4.950 3.465 N BID n/a
9 TRCN0000062708 CCTCCAAAGCTGTTCTGACAA pLKO.1 563 CDS 100% 4.950 3.465 N BID n/a
10 TRCN0000062710 TGGGAAGAATAGAGGCAGATT pLKO.1 697 CDS 100% 4.950 3.465 N BID n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_197966.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00161 pDONR223 100% 80.9% 80.9% None 1_138del n/a
2 ccsbBroad304_00161 pLX_304 0% 80.9% 80.9% V5 1_138del n/a
3 ccsbBroadEn_05891 pDONR223 100% 80.7% 80.9% None 1_138del;666T>C n/a
4 ccsbBroadEn_15368 pDONR223 0% 80.6% 80.4% None 1_138del;624C>A;666T>C n/a
5 ccsbBroad304_15368 pLX_304 0% 80.6% 80.4% V5 1_138del;624C>A;666T>C n/a
6 TRCN0000472971 ACAAAGGCACGTTGATGTCAATTG pLX_317 86.4% 80.6% 80.4% V5 1_138del;624C>A;666T>C n/a
Download CSV