Transcript: Mouse NM_197990.3

Mus musculus RIKEN cDNA 1700025G04 gene (1700025G04Rik), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
1700025G04Rik (69399)
Length:
9789
CDS:
519..884

Additional Resources:

NCBI RefSeq record:
NM_197990.3
NBCI Gene record:
1700025G04Rik (69399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_197990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192715 GATGTGTTTGGCGATGAGTAT pLKO.1 600 CDS 100% 4.950 6.930 N 1700025G04Rik n/a
2 TRCN0000189533 CCGTGGAAGAGGTCAAATACA pLKO.1 631 CDS 100% 5.625 3.938 N 1700025G04Rik n/a
3 TRCN0000201070 CTACCAGAATGGAGATGTGTT pLKO.1 587 CDS 100% 4.950 3.465 N 1700025G04Rik n/a
4 TRCN0000136683 GCAAACATGCACATCTCTGAA pLKO.1 780 CDS 100% 4.950 3.465 N C1orf21 n/a
5 TRCN0000138007 GAGATGTGTTTGGCGATGAGT pLKO.1 598 CDS 100% 3.000 2.100 N C1orf21 n/a
6 TRCN0000201360 GCCTAGTTTCTCTGCTTGAAA pLKO.1 1438 3UTR 100% 5.625 3.375 N 1700025G04Rik n/a
7 TRCN0000137197 GTGGAAGAGGTCAAATACATG pLKO.1 633 CDS 100% 4.950 2.970 N C1orf21 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2364 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_197990.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04238 pDONR223 100% 93.9% 96.6% None (many diffs) n/a
2 ccsbBroad304_04238 pLX_304 0% 93.9% 96.6% V5 (many diffs) n/a
3 TRCN0000465979 CATCCCAGCCAACTCTTCTTAGCA pLX_317 74.1% 93.9% 96.6% V5 (many diffs) n/a
Download CSV