Transcript: Mouse NM_198001.2

Mus musculus RIKEN cDNA 1110008P14 gene (1110008P14Rik), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
1110008P14Rik (73737)
Length:
674
CDS:
146..397

Additional Resources:

NCBI RefSeq record:
NM_198001.2
NBCI Gene record:
1110008P14Rik (73737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192128 CTCCATGTTGGATCAGATCAA pLKO.1 241 CDS 100% 4.950 6.930 N 1110008P14Rik n/a
2 TRCN0000328619 TGTTCTGGCCTGGGTAGATAC pLKO_005 444 3UTR 100% 10.800 7.560 N 1110008P14Rik n/a
3 TRCN0000192305 CAACTCCATGTTGGATCAGAT pLKO.1 238 CDS 100% 4.950 3.465 N 1110008P14Rik n/a
4 TRCN0000201094 CCATGTTGGATCAGATCAACT pLKO.1 243 CDS 100% 4.950 3.465 N 1110008P14Rik n/a
5 TRCN0000328618 CCATGTTGGATCAGATCAACT pLKO_005 243 CDS 100% 4.950 3.465 N 1110008P14Rik n/a
6 TRCN0000201014 CATCAACTCCATGTTGGATCA pLKO.1 235 CDS 100% 4.050 2.835 N 1110008P14Rik n/a
7 TRCN0000328617 CATCAACTCCATGTTGGATCA pLKO_005 235 CDS 100% 4.050 2.835 N 1110008P14Rik n/a
8 TRCN0000201825 GTATGCTGCCATCAACTCCAT pLKO.1 226 CDS 100% 2.640 1.848 N 1110008P14Rik n/a
9 TRCN0000328689 GTATGCTGCCATCAACTCCAT pLKO_005 226 CDS 100% 2.640 1.848 N 1110008P14Rik n/a
10 TRCN0000263834 CTGGAGGAGAAGAATGACCAC pLKO_005 278 CDS 100% 2.160 1.296 N C9orf16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198001.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04048 pDONR223 100% 90.3% 93.9% None (many diffs) n/a
2 ccsbBroad304_04048 pLX_304 0% 90.3% 93.9% V5 (many diffs) n/a
3 TRCN0000475190 TGTCCCCTCAAAAGGAAGTCTGAT pLX_317 100% 90.3% 93.9% V5 (many diffs) n/a
Download CSV