Transcript: Mouse NM_198037.1

Mus musculus cache domain containing 1 (Cachd1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cachd1 (320508)
Length:
4981
CDS:
451..4317

Additional Resources:

NCBI RefSeq record:
NM_198037.1
NBCI Gene record:
Cachd1 (320508)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339402 GAGCTCACCTTAGGCTCTAAA pLKO_005 4720 3UTR 100% 13.200 18.480 N Cachd1 n/a
2 TRCN0000339403 TCGTTGGACCAGTGCTATAAG pLKO_005 1321 CDS 100% 13.200 18.480 N Cachd1 n/a
3 TRCN0000339404 TGGTGATACAACCGGAAATAC pLKO_005 2306 CDS 100% 13.200 18.480 N Cachd1 n/a
4 TRCN0000198711 CCGGAAATACCCGTCAAACAA pLKO.1 2317 CDS 100% 5.625 7.875 N Cachd1 n/a
5 TRCN0000136576 CGTTACATAGCAACACCCAAT pLKO.1 2683 CDS 100% 4.050 5.670 N CACHD1 n/a
6 TRCN0000198802 CCGTTACATAGCAACACCCAA pLKO.1 2682 CDS 100% 2.640 3.696 N Cachd1 n/a
7 TRCN0000339335 TGGAATCAAGTGGCAATATTT pLKO_005 1038 CDS 100% 15.000 12.000 N Cachd1 n/a
8 TRCN0000198328 GCTCTAAACGATGCATCTCAA pLKO.1 4733 3UTR 100% 4.950 3.960 N Cachd1 n/a
9 TRCN0000339405 CCTTGAAGATGTGACATATTA pLKO_005 1968 CDS 100% 15.000 10.500 N Cachd1 n/a
10 TRCN0000182003 CCTGATGAACTGACCTGACAT pLKO.1 4490 3UTR 100% 4.950 3.465 N Cachd1 n/a
11 TRCN0000138738 CGTATGTCCAACCTGGAGAAT pLKO.1 3910 CDS 100% 4.950 3.465 N CACHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14235 pDONR223 100% 68.2% 73.9% None (many diffs) n/a
2 ccsbBroad304_14235 pLX_304 0% 68.2% 73.9% V5 (many diffs) n/a
3 TRCN0000480127 AGGCGTCCGTGCTTCAGTTAAATC pLX_317 11.8% 68.2% 73.9% V5 (many diffs) n/a
Download CSV