Transcript: Human NM_198156.3

Homo sapiens von Hippel-Lindau tumor suppressor (VHL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
VHL (7428)
Length:
4291
CDS:
71..589

Additional Resources:

NCBI RefSeq record:
NM_198156.3
NBCI Gene record:
VHL (7428)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039623 CCCTATTAGATACACTTCTTA pLKO.1 2106 3UTR 100% 5.625 4.500 N VHL n/a
2 TRCN0000039625 GATCTGGAAGACCACCCAAAT pLKO.1 506 CDS 100% 10.800 7.560 N VHL n/a
3 TRCN0000332965 GATCTGGAAGACCACCCAAAT pLKO_005 506 CDS 100% 10.800 7.560 N VHL n/a
4 TRCN0000010461 TAGGATTGACATTCTACAGTT pLKO.1 1322 3UTR 100% 4.950 3.465 N VHL n/a
5 TRCN0000344502 TAGGATTGACATTCTACAGTT pLKO_005 1322 3UTR 100% 4.950 3.465 N VHL n/a
6 TRCN0000039627 GTCGAAGAGTACGGCCCTGAA pLKO.1 128 CDS 100% 1.350 0.945 N VHL n/a
7 TRCN0000039624 GCCTAGTCAAGCCTGAGAATT pLKO.1 450 CDS 100% 0.000 0.000 N VHL n/a
8 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3266 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
9 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 2795 3UTR 100% 10.800 5.400 Y SMIM11A n/a
10 TRCN0000166498 CGCCTGTAATCCCAGTACTTT pLKO.1 2426 3UTR 100% 5.625 2.813 Y MGC13053 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2729 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2730 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3371 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3371 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198156.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07128 pDONR223 100% 99.8% 99.4% None 328C>T n/a
2 ccsbBroad304_07128 pLX_304 98.3% 99.8% 99.4% V5 328C>T n/a
3 TRCN0000474273 GTTTAGTATAACTCTTATATGGTT pLX_317 98.8% 99.8% 99.4% V5 328C>T n/a
Download CSV