Transcript: Human NM_198180.3

Homo sapiens pyroglutamylated RFamide peptide (QRFP), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
QRFP (347148)
Length:
1653
CDS:
522..932

Additional Resources:

NCBI RefSeq record:
NM_198180.3
NBCI Gene record:
QRFP (347148)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198180.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242578 ACATCGGGCAGAGAGCATGCT pLKO_005 747 CDS 100% 0.880 1.232 N QRFP n/a
2 TRCN0000242579 AGAGCATGCTGGCTGCAGATT pLKO_005 758 CDS 100% 4.950 3.465 N QRFP n/a
3 TRCN0000242576 CACAGGCCCTGCTTGTCATAG pLKO_005 712 CDS 100% 3.600 2.520 N QRFP n/a
4 TRCN0000122734 CCACAGGCCCTGCTTGTCATA pLKO.1 711 CDS 100% 1.650 1.155 N QRFP n/a
5 TRCN0000242580 TCTCGGTGGCTGAGAGCTTCA pLKO_005 687 CDS 100% 1.350 0.945 N QRFP n/a
6 TRCN0000242577 GCTTCCCTCTACTGGACAGAA pLKO_005 574 CDS 100% 4.950 2.970 N QRFP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198180.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15309 pDONR223 75.1% 98.7% 97.7% None (many diffs) n/a
2 ccsbBroad304_15309 pLX_304 0% 98.7% 97.7% V5 (many diffs) n/a
3 TRCN0000469734 CAGGACATTGCCGCAAGAACTCTA pLX_317 100% 66.1% 66.1% V5 267_268delGAinsTC;272A>G;274_408del n/a
Download CSV