Transcript: Mouse NM_198214.3

Mus musculus syntaphilin (Snph), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Snph (241727)
Length:
4750
CDS:
293..1879

Additional Resources:

NCBI RefSeq record:
NM_198214.3
NBCI Gene record:
Snph (241727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198214.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381355 ACACACTATGCAGCGACAATC pLKO_005 564 CDS 100% 10.800 15.120 N Snph n/a
2 TRCN0000190577 GCTCCATGAAGTACACACTAT pLKO.1 552 CDS 100% 4.950 6.930 N Snph n/a
3 TRCN0000379706 ATGGAGCTGATAGTGGATATG pLKO_005 1107 CDS 100% 10.800 7.560 N Snph n/a
4 TRCN0000381285 CCCAACCCAAGATGTCAATAG pLKO_005 2007 3UTR 100% 10.800 7.560 N Snph n/a
5 TRCN0000201826 GATGGAGCTGATAGTGGATAT pLKO.1 1106 CDS 100% 10.800 7.560 N Snph n/a
6 TRCN0000147156 CAAGAACAACCTGATTGACAA pLKO.1 847 CDS 100% 4.950 3.465 N SNPH n/a
7 TRCN0000190007 GCCAGCCCATTTACAACATCA pLKO.1 1749 CDS 100% 4.950 3.465 N Snph n/a
8 TRCN0000148668 CAACCTGATTGACAAGGACAA pLKO.1 853 CDS 100% 4.050 2.835 N SNPH n/a
9 TRCN0000149181 CACTGTCAAGAACAACCTGAT pLKO.1 841 CDS 100% 4.050 2.835 N SNPH n/a
10 TRCN0000202136 CCAGACAGACTTTGTGCAGTA pLKO.1 1333 CDS 100% 4.050 2.835 N Snph n/a
11 TRCN0000201959 CAGTATCTGACTCCACTGCAA pLKO.1 611 CDS 100% 2.640 1.848 N Snph n/a
12 TRCN0000129059 GAACAACCTGATTGACAAGGA pLKO.1 850 CDS 100% 2.640 1.848 N SNPH n/a
13 TRCN0000148877 CATCGACACTGTCAAGAACAA pLKO.1 835 CDS 100% 4.950 2.970 N SNPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198214.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07482 pDONR223 100% 82.1% 85.1% None (many diffs) n/a
2 ccsbBroad304_07482 pLX_304 0% 82.1% 85.1% V5 (many diffs) n/a
3 TRCN0000474208 CCCAGGGATGCGTGTCCGCGGATT pLX_317 31% 82.1% 85.1% V5 (many diffs) n/a
Download CSV