Transcript: Mouse NM_198410.3

Mus musculus progestin and adipoQ receptor family member VI (Paqr6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Paqr6 (68957)
Length:
1689
CDS:
61..1092

Additional Resources:

NCBI RefSeq record:
NM_198410.3
NBCI Gene record:
Paqr6 (68957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198410.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126708 TGCTCGTCACATCTGCTACTT pLKO.1 387 CDS 100% 4.950 3.465 N Paqr6 n/a
2 TRCN0000126706 GATGACTAATGAGACGGTCAA pLKO.1 192 CDS 100% 4.050 2.835 N Paqr6 n/a
3 TRCN0000126707 CCTGGGCGCTTCGACTATATT pLKO.1 796 CDS 100% 15.000 7.500 Y Paqr6 n/a
4 TRCN0000126705 GCAGTGATTGGGAACCTGTTT pLKO.1 970 CDS 100% 4.950 2.475 Y Paqr6 n/a
5 TRCN0000126704 GCGACTATTCTGACCCTGAAA pLKO.1 1173 3UTR 100% 4.950 2.475 Y Paqr6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198410.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04151 pDONR223 100% 83.5% 87.2% None (many diffs) n/a
2 ccsbBroad304_04151 pLX_304 0% 83.5% 87.2% V5 (many diffs) n/a
3 TRCN0000475775 TGTCACAGTGGTTACAGCCTGAAA pLX_317 30.1% 83.5% 87.2% V5 (many diffs) n/a
Download CSV