Construct: ORF TRCN0000475775
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008557.1_s317c1
- Derived from:
- ccsbBroadEn_04151
- DNA Barcode:
- TGTCACAGTGGTTACAGCCTGAAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PAQR6 (79957)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475775
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272104.2 | 100% | 100% | |
| 2 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_198406.3 | 100% | 100% | |
| 3 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272105.2 | 99.1% | 99.1% | 41_42insGGTCCCCCG |
| 4 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_006711546.2 | 75.2% | 58.2% | 760_830del;1104_1371del |
| 5 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_006711547.4 | 75.2% | 58.2% | 760_830del;1104_1371del |
| 6 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_006711548.4 | 70% | 53% | 0_1ins72;688_758del;1032_1299del |
| 7 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272107.2 | 69.1% | 69.1% | 0_1ins318 |
| 8 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272108.2 | 67.7% | 67.7% | 178_179ins333 |
| 9 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NR_073610.2 | 53.5% | (many diffs) | |
| 10 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_024897.3 | 52% | 35.6% | 0_1ins318;442_512del;786_1053del |
| 11 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_006711552.3 | 50.9% | 34.5% | 178_179ins333;427_497del;771_1038del |
| 12 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_006711553.4 | 50.9% | 34.5% | 178_179ins333;427_497del;771_1038del |
| 13 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XR_002957631.1 | 49.8% | 1_126del;637_638ins97;1062_1778del | |
| 14 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XR_001737427.1 | 48% | (many diffs) | |
| 15 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XR_001737428.2 | 46.5% | (many diffs) | |
| 16 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272106.1 | 41% | 11.2% | (many diffs) |
| 17 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272109.1 | 28% | 14.5% | 0_1ins667;366_633del |
| 18 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272110.2 | 28% | 14.5% | 0_1ins667;366_633del |
| 19 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272111.2 | 28% | 14.5% | 0_1ins667;366_633del |
| 20 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272112.1 | 28% | 14.5% | 0_1ins667;366_633del |
| 21 | human | 79957 | PAQR6 | progestin and adipoQ recept... | NM_001272113.1 | 28% | 14.5% | 0_1ins667;366_633del |
| 22 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_005245494.4 | 28% | 14.5% | 0_1ins667;366_633del |
| 23 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_024449879.1 | 28% | 14.5% | 0_1ins667;366_633del |
| 24 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_024449880.1 | 28% | 14.5% | 0_1ins667;366_633del |
| 25 | human | 79957 | PAQR6 | progestin and adipoQ recept... | XM_024449881.1 | 28% | 14.5% | 0_1ins667;366_633del |
| 26 | mouse | 68957 | Paqr6 | progestin and adipoQ recept... | NM_198410.3 | 83.5% | 87.2% | (many diffs) |
| 27 | mouse | 68957 | Paqr6 | progestin and adipoQ recept... | XM_017319706.1 | 79.9% | 82.6% | (many diffs) |
| 28 | mouse | 68957 | Paqr6 | progestin and adipoQ recept... | XM_006502007.2 | 77.9% | 81.3% | (many diffs) |
| 29 | mouse | 68957 | Paqr6 | progestin and adipoQ recept... | XM_006502010.3 | 77.9% | 81.3% | (many diffs) |
| 30 | mouse | 68957 | Paqr6 | progestin and adipoQ recept... | XM_006502009.3 | 74.9% | 78.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1101
- ORF length:
- 1032
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctcagtctc aagctgcccc aacttcttca agtccaccag gtcccccggg 121 tgttctggga agatggcatc atgtctggct accgccgccc caccagctcg gctttggact 181 gtgtcctcag ctccttccag atgaccaacg agacggtcaa catctggact cacttcctgc 241 ccacctggta cttcctgtgg cggctcctgg cgctggcggg cggccccggc ttccgtgcgg 301 agccgtacca ctggccgctg ctggtcttcc tgctgcccgc ctgcctctac cccttcgcgt 361 cgtgctgcgc gcacaccttc agctccatgt cgccccgcat gcgccacatc tgctacttcc 421 tcgactacgg cgcgctcagc ctctacagtc tgggctgcgc cttcccctat gccgcctact 481 ccatgccggc ctcctggctg cacggccacc tgcaccagtt ctttgtgcct gccgccgcac 541 tcaactcctt cctgtgcacc ggcctctcct gctactcccg tttcctggag ctggaaagcc 601 ctgggctcag taaggtcctc cgcacaggag ccttcgccta tccattcctg ttcgacaacc 661 tcccactctt ttatcggctc gggctgtgct ggggcagggg ccacggctgt gggcaggagg 721 ccctgagcac cagccatggc taccatctct tctgcgcgct gctcactggc ttcctcttcg 781 cctcccacct gccTGAAAGG CTGGCACCAG GACGCTTTGA TTACATCGGC CACAGCCACC 841 AGTTATTCCA CATCTGTGCA GTGCTGGGCA CCCACTTCCA GCTGGAGGCA GTGCTGGCTG 901 ATATGGGATC ACGCAGAGCC TGGCTGGCCA CACAGGAACC TGCCCTGGGC CTGGCAGGCA 961 CAGTGGCCAC ACTGGTCTTG GCTGCAGCTG GGAACCTACT CATTATTGCT GCTTTCACAG 1021 CCACCCTGCT TCGGGCCCCC AGTACATGCC CTCTGCTGCA GGGTGGCCCA CTGGAGGGGG 1081 GTACCCAGGC CAAACAACAG TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1141 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1201 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATGTC ACAGTGGTTA 1261 CAGCCTGAAA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt