Transcript: Mouse NM_198425.2

Mus musculus EP300 interacting inhibitor of differentiation 2 (Eid2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Eid2 (386655)
Length:
1299
CDS:
75..785

Additional Resources:

NCBI RefSeq record:
NM_198425.2
NBCI Gene record:
Eid2 (386655)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198425.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194002 GAGGTGATCAATCCTCTAATA pLKO.1 726 CDS 100% 13.200 18.480 N Eid2 n/a
2 TRCN0000193686 CGTGGCTTCGTTAATAAGTAA pLKO.1 1015 3UTR 100% 5.625 7.875 N Eid2 n/a
3 TRCN0000175058 GTGATCAATCCTCTAATAGAA pLKO.1 729 CDS 100% 5.625 7.875 N Eid2 n/a
4 TRCN0000175259 CAATCCTCTAATAGAAGAACT pLKO.1 734 CDS 100% 4.950 3.960 N Eid2 n/a
5 TRCN0000176340 CCTACCGTTTCTTGAGTTTAT pLKO.1 953 3UTR 100% 13.200 9.240 N Eid2 n/a
6 TRCN0000174034 CGAGGTTTCTGTGGAGAACTT pLKO.1 1125 3UTR 100% 4.950 3.465 N Eid2 n/a
7 TRCN0000173653 CATCAATTACCAGCAGTTCCT pLKO.1 524 CDS 100% 2.640 1.848 N Eid2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198425.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.