Transcript: Human NM_198427.2

Homo sapiens brevican (BCAN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
BCAN (63827)
Length:
2689
CDS:
168..2183

Additional Resources:

NCBI RefSeq record:
NM_198427.2
NBCI Gene record:
BCAN (63827)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156283 CCCAACGACTCAGGTATCTAT pLKO.1 552 CDS 100% 5.625 7.875 N BCAN n/a
2 TRCN0000371366 TCGGATCAGACCGTGAGGTAT pLKO_005 792 CDS 100% 4.950 3.960 N BCAN n/a
3 TRCN0000158373 CTCAGGTATCTATCGCTGTGA pLKO.1 560 CDS 100% 2.640 2.112 N BCAN n/a
4 TRCN0000158407 CAATAAGCACAGCCGCTTCAA pLKO.1 1193 CDS 100% 4.950 3.465 N BCAN n/a
5 TRCN0000156981 CCTAGGACGCTCCTAGAATTT pLKO.1 1449 CDS 100% 1.320 0.924 N BCAN n/a
6 TRCN0000151872 CATTGGAGGAAGAAGAGAAAT pLKO.1 1522 CDS 100% 13.200 7.920 N BCAN n/a
7 TRCN0000371365 TGTTATGCTGAAGACCTAAAT pLKO_005 915 CDS 100% 13.200 7.920 N BCAN n/a
8 TRCN0000155073 GAAGAAGAGAAAGAGGAGGAA pLKO.1 1551 CDS 100% 2.640 1.584 N BCAN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198427.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08807 pDONR223 100% 72.7% 71.1% None (many diffs) n/a
2 ccsbBroad304_08807 pLX_304 0% 72.7% 71.1% V5 (many diffs) n/a
3 TRCN0000473722 CTATTGGGCCTCGGTGTAGCCCAA pLX_317 11% 72.7% 71.1% V5 (many diffs) n/a
4 ccsbBroadEn_08806 pDONR223 100% 72.7% 71.1% None (many diffs) n/a
5 ccsbBroad304_08806 pLX_304 0% 72.7% 71.1% V5 (many diffs) n/a
6 TRCN0000465406 GGGTTACTCTTTATCGCTAATTCC pLX_317 11.7% 72.7% 71.1% V5 (many diffs) n/a
Download CSV