Transcript: Human NM_198525.3

Homo sapiens kinesin family member 7 (KIF7), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KIF7 (374654)
Length:
4567
CDS:
94..4125

Additional Resources:

NCBI RefSeq record:
NM_198525.3
NBCI Gene record:
KIF7 (374654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116758 GCGCAGAAATAGGATCAGCAA pLKO.1 2010 CDS 100% 2.640 3.696 N KIF7 n/a
2 TRCN0000116761 GCTGGCTATCAACATCCGCAT pLKO.1 2229 CDS 100% 2.160 3.024 N KIF7 n/a
3 TRCN0000421192 AGCCCTCCTCTGCAAGTATTT pLKO_005 3384 CDS 100% 13.200 10.560 N KIF7 n/a
4 TRCN0000430264 CCCTCACTGGGATCAACAAAT pLKO_005 4248 3UTR 100% 13.200 9.240 N KIF7 n/a
5 TRCN0000426679 GGCCGTTACATGTGGATAAAC pLKO_005 3685 CDS 100% 13.200 9.240 N KIF7 n/a
6 TRCN0000116757 CCCACCACTTACTTCCATGAA pLKO.1 4324 3UTR 100% 4.950 3.465 N KIF7 n/a
7 TRCN0000116759 GAAGATTAAGACGGAAGAGAT pLKO.1 2724 CDS 100% 4.950 3.465 N KIF7 n/a
8 TRCN0000116760 TGAGTATAAGAATGAGGCCAT pLKO.1 3261 CDS 100% 2.160 1.512 N KIF7 n/a
9 TRCN0000139534 CAATGCCACTGTCTTTGCCTA pLKO.1 351 CDS 100% 2.640 1.320 Y KIF19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198525.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13627 pDONR223 100% 61.7% 61.6% None (many diffs) n/a
2 ccsbBroad304_13627 pLX_304 0% 61.7% 61.6% V5 (many diffs) n/a
3 TRCN0000476193 GACCTCCTATACTGGGTTCTGTCC pLX_317 12.5% 61.7% 61.6% V5 (many diffs) n/a
Download CSV