Transcript: Human NM_198562.3

Homo sapiens chromosome 3 open reading frame 62 (C3orf62), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
C3orf62 (375341)
Length:
3748
CDS:
361..1164

Additional Resources:

NCBI RefSeq record:
NM_198562.3
NBCI Gene record:
C3orf62 (375341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412651 ATTGAGTAAGGACAGTTATCT pLKO_005 1156 CDS 100% 5.625 7.875 N C3orf62 n/a
2 TRCN0000172631 GCCCGAACAAACCAAAGAGTT pLKO.1 2345 3UTR 100% 4.950 6.930 N C3orf62 n/a
3 TRCN0000167659 GAAAGATATGGAGAGAGATTT pLKO.1 807 CDS 100% 13.200 9.240 N C3orf62 n/a
4 TRCN0000417713 GGTTGGCAGAACCTGAATTAC pLKO_005 1263 3UTR 100% 13.200 9.240 N C3orf62 n/a
5 TRCN0000433483 AGGATCTGCTTGATATGATTG pLKO_005 878 CDS 100% 10.800 7.560 N C3orf62 n/a
6 TRCN0000435933 TGCTTTGAAATGTTTCCTATT pLKO_005 1349 3UTR 100% 10.800 7.560 N C3orf62 n/a
7 TRCN0000172875 GAGACTGTTCTGGACTTGGAA pLKO.1 1099 CDS 100% 3.000 2.100 N C3orf62 n/a
8 TRCN0000168405 GATTCACCCTTCAAAGAGGAA pLKO.1 985 CDS 100% 2.640 1.848 N C3orf62 n/a
9 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3463 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198562.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05546 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05546 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475418 ATTCCGATTGTCCAAACTTGACCG pLX_317 44.2% 100% 100% V5 n/a
4 ccsbBroadEn_10070 pDONR223 100% 99.8% 99.6% None 211G>T n/a
5 ccsbBroad304_10070 pLX_304 0% 99.8% 99.6% V5 211G>T n/a
6 TRCN0000474443 AAGCTGCCCGTACATACACTTCCT pLX_317 47.7% 99.8% 99.6% V5 211G>T n/a
Download CSV