Transcript: Human NM_198794.3

Homo sapiens mitogen-activated protein kinase kinase kinase kinase 5 (MAP4K5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
MAP4K5 (11183)
Length:
4364
CDS:
280..2820

Additional Resources:

NCBI RefSeq record:
NM_198794.3
NBCI Gene record:
MAP4K5 (11183)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195575 CAGGATTAGCTGCCCATATTC pLKO.1 2048 CDS 100% 13.200 18.480 N MAP4K5 n/a
2 TRCN0000197036 GACGTCTATAAGGCCAGAAAT pLKO.1 376 CDS 100% 13.200 18.480 N MAP4K5 n/a
3 TRCN0000002189 GCTCTACTCTCACAATCTTAT pLKO.1 2001 CDS 100% 13.200 18.480 N MAP4K5 n/a
4 TRCN0000195599 CCTATGGTCTGTGTAGCTATT pLKO.1 2335 CDS 100% 10.800 15.120 N MAP4K5 n/a
5 TRCN0000197209 GTAACATCGTTGCCTACTTTG pLKO.1 503 CDS 100% 10.800 15.120 N MAP4K5 n/a
6 TRCN0000002187 GCCACCTATGTTTGATCTCCA pLKO.1 924 CDS 100% 2.640 3.696 N MAP4K5 n/a
7 TRCN0000197246 GACAGACCATGGCGATGTAAA pLKO.1 723 CDS 100% 13.200 10.560 N MAP4K5 n/a
8 TRCN0000197245 GCCACTGTGTGGTGGTTATAT pLKO.1 3004 3UTR 100% 15.000 10.500 N MAP4K5 n/a
9 TRCN0000362467 TGGAACTGAAGATGGTATTTA pLKO_005 1860 CDS 100% 15.000 10.500 N Map4k5 n/a
10 TRCN0000002190 CAAAGTGAACAATCCAGATAA pLKO.1 1155 CDS 100% 13.200 9.240 N MAP4K5 n/a
11 TRCN0000194753 CCTGATGGGATAGTATCAATA pLKO.1 3883 3UTR 100% 13.200 9.240 N MAP4K5 n/a
12 TRCN0000194698 CTTGCCTATTTGCATACTAAA pLKO.1 661 CDS 100% 13.200 9.240 N MAP4K5 n/a
13 TRCN0000197179 GCTGGAAACAGCTAGTCTATC pLKO.1 2979 3UTR 100% 10.800 7.560 N MAP4K5 n/a
14 TRCN0000197122 GCTGTGTCTACCATGTGTATG pLKO.1 3602 3UTR 100% 10.800 7.560 N MAP4K5 n/a
15 TRCN0000362469 GTGGTGGTTATATCAAGTTTG pLKO_005 3012 3UTR 100% 10.800 7.560 N Map4k5 n/a
16 TRCN0000002188 CAACAAAGATTCCTGATACAA pLKO.1 2117 CDS 100% 5.625 3.938 N MAP4K5 n/a
17 TRCN0000002191 CTCTACATCTTGGCTGGACAT pLKO.1 2785 CDS 100% 4.050 2.835 N MAP4K5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198794.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14987 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14987 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481402 CAGCAATATACCGATGTCGAACGT pLX_317 16.1% 100% 100% V5 n/a
4 TRCN0000489738 ACGTTCGTAGTTTCTTTTAGTTTC pLX_317 15.9% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV